Description :
From Genome Similarity Track
Location :
Scaffold_915:8- 1928
Sequence
1920 bases(100 bases per row)
CAAACACTTCTCAGCCTCCGACGCTTGATCTATCATGAGGGCCGACTTGACTTTGCTGATTCATGTTCTCGCTCGGTCCTCATCTGGATCCTTGCCCGTG
AACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCACGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGCGG
ATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTTCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTG
CACTTGTGGCACGGGCGCTCTCATACCATGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAG
CCTGTGGACGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTC
GATCCTGGCCAGATTGTATCAAATCACGGGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCCCGGATCCTCGCCCGCGCTTC
CAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCT
TGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACCCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGA
GGTCCAAGTCTAGCTCAAAGATATCATCTGCGTCGAGCACACCAGCTACGATGCCTGACTCCGTAAGCTAACGTAGTAGATCCTGGACTGCCACCAACTT
GTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCAGAAAATCGCGT
AGAGCTTGATGGCAATACACAAACTCGAGGTCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCG
TAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCCTAACCGGTGAATCTGCAAATGCATACCG
TTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGCACCTGGGGAGGATAGAAAGGTTTCTCTT
CTAGATCCGGATCCGGTTCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGACCTTGTTTCATTCAGCAGCGTCTTCGTCGA
TCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACG
CGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGA
TGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGAGGTGAAGCTTG
AGTGTCTTGGCGAGACGTGGGGATGGAGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTA
TGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTG
TGACGGGATCTTGAGAGTTG