Description :
From Genome Similarity Track
Location :
Scaffold_4877:8- 1912
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4877-snap-gene-0.1Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1904 bases(100 bases per row)
TGGAGCATTGTCATGCTGAATGTTGTCACTGACTTGTTGCTGTGGGTGGACACGTACGTGAATCTCAACTTGACGTTCGTTGAAGATTCGGAGAAGATTT
GGGACACGACTCGCACAGCCATCCGGTACTCCAAGAGCTGGTTGGTCACTGATGTGATGTGTGTCTTCCCATATTGGTTCTTCGCCCGGTCAGTTCACCA
CGCCCTGCCTCGGATACCGCGGCTGCTTCGAGTGATTCGGCTTCGAGGTCAATTGCGCGAAATCGACGATTTTGTCAAGTTCACAAGCAAGCAGCGTCTA
TTTCTCTTTGGTATTCTGTTGGTCGTGTTGTACCACATTGTGGCGTGCCTGCACTTCAGTGTCAGCTATCTCGAGGGATTCAGCCACTCGTACAACGCAT
GGATACCTTCGGACGACATGTATTTGGCGTCTGTGAACACCTCGCACTACGTTGACAAGAACATGCGCCTGTATCGCCGCGACGATCCCTTCGTAATCTC
ATTGGGCATGAAGCAGTACTTCCGTTCGCTATATTACGCTGCGAACGTGCTCACGGCTCTCGGTCTCACCATTGAACCGGCAAGTGATATCCAGTACGGC
GTGGCCCTGCTCTTCATGCTCAGCGGCTTCTTCATCACAGCCATTGTTGTTGACAATGTCCAGAAGCGTTTCACGGCGTCAGCATTCGAACAGAAGGAAT
TTTTTGCCACGCGGTCTCGGATACAGTTGTTTCTGCGGCGACAAAATGCACCTTTGCTGATCCATAAGAGGGTGAATGCGTTCCTCGATTATTGGTGGTC
GTCTCATCGAGGAGCAGTAATCAGCGAACTGCTCGAGGAACTGCCCGAGACGACCAAGCAAGAGATTTTACAGAGTATCTGCCAACCAGTTCTTCAAACG
CTTGCGCTGCTGAACGGAGTGCGTCCAGTGCTGTCGGAGCTAGAACGCGTCTTTCTCGACAACGCTCGATTCATTCTCTACGGTCAAGGAGAAATTGTCT
ACCGACAAGGCGACTTTGCGAACGGTCTTTTCTTCTTGCTCTCGGGTGAGATTTCCATCTTCACGATTGACGCCGAGCCGCGATCAGTTCATCAAGGTGG
ATTTTTTGGTACTGCCGCGCTGGATCTAGACGGAACCGCAGTCAGCTACGCAGAGTCCGTGACGGCAACAAGTGGAATCATGGTGTTGTTCGTCTCAAGG
CAGCACATTCAAGCAATGATTGGTGCGTACCCATCGCTCGTGAACTCACTGAGAGCACTCGAAATGCGTCTGCTGGATCCAAAGCTCGCCAAATCTATAC
TGGTCCCAATCGGCGGTGGCAAATCAAACAGCGGGCGCACTGGTGGAGTTCTGCTCCAGTTAAGAATGTGCTTCGACCGAGTCTTCGACCCTGACTCCCG
GCAAATGCTGGCGTGGGAGACGTGGCTCTTTCTGCTCATGACGCTCGAGTGGATTCTGATCATGTTCCACATTTGCTTCGGTGTCTCAGAGATTCGAACA
TCGACAAACGACAGCGTGCTGATGCTGATTGAGCTCCACTTCGTCGTCGACATTTACGTTCGCAGCCACCTCGGATACTCGGAGTTCGGTAACAAAATCA
TGCTCGCAAAGAACATTCGCCAGCGATACTTTCGATCTCGAGAGTTTGTCGTCGACCTCATCGCAATTGTCCCGTTGTTCATGGTGAACTGGGGGCTCCC
TCCCCCGACCCGCAACGAAGCGCTCAACATTAACAAACTGCTCCGACTAACCAAGGTACCGACCCAGTTCATGGCGCTGGAGAACAAGTACATCAAGCGC
ACGCTTGAACTGCGGCTGTTCAAGCTCGTGTATTACACGTTCCTGCTTACGCATCTCTTCGGCTGTGTGTGGTTCGACTTTGCGTCGAATGCGTCCGGAA
TTCA