Description :
From Genome Similarity Track
Location :
Scaffold_1956:8- 1896
Transcript NameFunction/comments
Phypl_g14451hypothetical protein PHYSODRAFT_332764

Sequence
1888 bases(100 bases per row)
GTGCTTGGTGGCACCATCGGTTGAGCTTCATATGCGGGGCTCTTGGGCGTACCATGTGAACCAGACGTCCTTCaggtttgttgctgctgctgcacggcgt
cgctttgctggtggctcaTTACTTGTGTCTCACCTGTTTCGTTTGTGTCTGGTGTCTATTGCGGCTTGTTGTAGACTTTAGCCTCCATCGTAGACAGCCG
AGCGTCGAGCTTGTGGTTGACCTGAATTAACTGTTCCATCAAGGCGGCTCGGTGAAGAAACGTTGGGTGCTTGGTGATATCGCTCGTGCTGTCATGGGAC
TTGGTGTTGTCGGCTTGAGGAGTTGTGCTCATATAACAGGCCAGGTGCGAAGACCAAGCTAGAAGCTCGTTGATGGTGTGGCCTTTTTCAATGGCACACG
CTTCAAGACACTCGACAGCAAGTCCGCccgcctcgagctgcttcagcgatgGATAGGAATGTCAAGAGAGTATCAAGCATCCTTCCATTCACGTTGTACT
GCGCTGTCTTGACTCCGTAGGACGAGTTGAAGAGCGTCGATGCGACGGTTCGAATCTTCGTCTGGGTGTCGGAGTCGAACCAATCCAACGACAAGAGAGG
AACTACTTGATCAGGACCCCGGCCACTCAAGACGCGAGCGACCTAGTGATCTTCGGCCGGTGTGTTGAAGACGTACGCGAAGGATTTGTTCATCGCTGTC
ATATTCCAGGCTCCCCGGTCGAAGATCCACTTCACGCACATGCCTGCTCCATTGGCGAAAGGAATGCGATGTGAGGCGCTCGGTCACACCAGCCTTTTTC
GCGACTCTCTCCAGGACGCGGTTGACGTAGCTGTGGATGCTCGGGGCAGAGTTAATGGTCTTCCCTTCATCCGAGCGAGTTGCTTGTGCCGATACAGTAG
GCCCTGGGTGGTCGATCAAGTCGTCGGAGAAGCTTGGGTCGCCAGTGCAAGCGCAATCGGGAACAGTGGACACGCGGTGAAATCGTCGTCAGGAAACGGC
GAGAGGCCCTGTTCTTCGGCAGTCTTGATCCGCATGAAGcgcacgaagaaggcgtcgcACGCGCCGATGGACAGGTTGGCCTTGCGAAGCAGCGTAAGGT
CCGACGCACGCCCGACAAGGAACCACAGTaagctcagcagcacggcgtcctgATAGTCTGCGGAGGTAACAGCAGCCGAGAAGAGATACACCATTatctg
cttgagcgcgttcTTCGTGCACGCAAGAGCCTTGTTAATGAAGGCGCCCGACTCTCTCTTCAACCAATAACGTTCCAGTGTTTGCcacttcttgagcagc
gtctcgtcAATGGCCGCTCGATGCTGAGGAAACTGGTCCAACAGCCAGTTCTTGGCCTGTCGGTAGTACTGCATGACCGAGTTTCGAGCCAATAGCTTGC
CCTTACGGCCCTTCTTGAAGGCGAGCTGCATGCCGAACTTGTCCACCACAGCTTCCAGGACAATCGCGgcacgctcgcgctgcatgaCCAGTTCCAGGTA
CTCCCAACTgacgtcttcctcctcgaggAACTTCAGAAACGAGCGCGCTGCGGACTCGCGAGCAAGCTTAGTTTTTACAGGTGTGAGGTCGTTCAGGCTC
ATCTTGCGTCGGAGGTGTCAGAGCTTGGGTATTATTCGAGAAATTTGCGAATGACTTGCCATCTGTAGAGAGATAATAACAACTTCAGTGCTCCCTCCGA
CCCGATACGTCGGAGGTGTGGCTGTCAGGCAGTCACCAATCCGCGACCTATCTGATTGGTCAACATTGTTTGCGTAGATCAATTTGATTCGCTAAAAGCC
GAGATATTACCAAGTAATACAATCTATTGGTCGATAATATCAAGAGTAAGTTCAAGTATTGTCGGAGATGTGACGATATTCATCCATA