Description :
From Genome Similarity Track
Location :
Scaffold_157:8- 1856
Transcript NameFunction/comments
g10577.t1hypothetical protein

Sequence
1848 bases(100 bases per row)
AGAGAGAGCGGGACTCTCAGTGTCCACTAGCGAGAAGCTTAAAGCGTTGATATTCTCTTCCACAATCATCGATGGAAAGCTCCAGAAATGGCTCAACAGC
GGCAAAAATGCAGACACCGTTTTCTCGCGCATGAAGCTTACCAAGGCTGGGGATGACCTGCTTTCTAACCCACAGTTCTCCGTGTGGATCAAGTACGTGG
ATGATTTGAGTACCAAGTACCCAGCCAAAGCGACGTCGGCGATCTCGACGCTGACGACTCAATACGGCGATGATGCACTGTATAAATTGCTAGAATCTGC
GAAGAAGCTCCCAAGGACAGAAAATCTCGCCACCAGGCTGCAAGCCGAGCAGATCCAGCATTGGGCTACCGTTGGTAAATCCCCTGACGACGTCTTTCGT
CTGTTCGGTCTCCGAAGAGCAGGAAGTTCCCTTCTCACATACCCGAAGTTTACCTCGTGGGCCTCGTACCTGGATAACTTCAATGCACTGAATCCGGAGA
AGGCAACGTCGATGATCCCAACGTTGACGGCTTACTACGGTGAAACATTATTATTCAAGATGCTTGATGCCGACAAGAAGTTGGACGTAACAAAAAGCAT
CGCCACCAAGTTGGAGGCCCAGCAGCTTCAGGGATGGCTGAGGAGTGGGAATACACCGGACAGTGCTTTCGTACATATGGGACTTGGCGGTGTCGGGGAT
AATTTGTTGGCAAATCCGCTTTTCAGCACGTGGGTCAAGTACCTGGATGATTTCAATGCACAATACCCCGCGGAGAAAACTACTCTGCTCCATCTTTTGT
CGAACAGGTTCAAGGATGAACGTCTGGCAAAGATTATTGCTTTCGGAAAGACACTTGACAGGTCGAAGGCGGCTGCAACAAAGTTGGAGACCCAGCAGCT
TCAGGGGTGGCTGAGGAGTGGGAAAGCACCGGACAGTGCTTTCGTACAGTTGGGACTTGGCGATGTCGGGGATAATGTGTTGGCGAGTCCGCTTTTCAGC
ACGTGGGTCAAGTACCTGGATGATTTCAATGCACAGTACCCCGCGGAGAAAACAACTCTGTTTCGTGTTTTGGCGAGGGGGTACGAGGACGAAGCTTTGA
TAAAAATTATTGCTTTCGGAAAAACATCTGCCAGTGCGAAGATATCCGCAACAAAGTTGGAGACTCAACAGCTTCAGGGATGGCTGAGGAGTGGGAAAAC
ACCGGACAGTGCTTTCGTACAGTTGGGACTTGGTAAAGTTGGGGATAGTCTGCTGGCGAGTCCGCTTTTCAGCACGTGGGTCAAGTACCTGGATGATCTC
AATGCGCAGTACTCAGCGAAGGAAACAACTCTGTTTCATGTTTTAACGAAGAGAGTCAAGGATAAACTTCTGGCAAAGATTATTGCTTTCGGAAAGACAC
TGGACAGTACGAAGGCAGTGGCGACAAGGTTGGAGAACCAACAGAGGCAAATCTGGCTGACCAGTGGTAAATCATCGGACGACGTCTTCACGCTGCTGAA
ACTTGACAAAGCACCAGACAATTTCTTCGACAATCCGCTGTATAAGACGTGGGGCTCGTACATGAACGTCTACAACAACAAACATCCGGGGAAGCAAACG
AACTTGTTCAAGACGTTGACGACCAAGTGCAAAGACAAACCATTGATCAAAATCCTCGAGGAGGCGAAGAAGTTTCCGAATCTCGAAAGCACTGCCAGCA
AATTGCAGACGGAGAAGATCCAGAGTTATCTCGCCAGCAAGAAATCTCCCGATGAAGTCTTCACGCTGCTTGGACTCGGCGATGCATGGGACAATGTTAT
TGGCAATCCACTGTTCAAGACGTGGCTCACCTACGTGAAAACGTTCGA