Description :
From Genome Similarity Track
Location :
Scaffold_4001:8- 1640
Sequence
1632 bases(100 bases per row)
ATCGAAACTCAGGACGTGCACATCCGCTTCCACTTGCACCGTCGGGATCGGAATCTGGATCCGGCGTTTGTGCTCTTTCTTAGGAGCGATCCTGGTCAGC
GCTTCGTCCATCTTGGCTCTGGGTGTGATGCTCGCTGCCAAACTCCCAGGATCTCGTCTTCTCCTTTCGAACATTTCACGATTTCCAGTGTCCAAGGTGA
GAGTAACGCTAAACGCTGCCCATTGCCCCAACCGTCCTTGTAGACCGGCCGATTTGAACGGCCAAGCGAGCGTAGAGTGTCGAGTCAAGATCCGGATGGA
TCTTCCCACCAGCAGATTGTAATTGAGAGCCAACACCGGCAGGAGCGCGAGTATCTCCTTCTCCACCGCTCCGTAATTCAGCTCATTCGGCTTTAGCGTT
CGGCTGACGAAGGTGACTGGATGGCAGATCCCCTCATGTTCTTGTACCAAGGCTGCTGAGATTGCCCAGTCACTAGCATAAACTATCACCGTAGGTTGAC
GTTCCGGATCGAAATGACGGAGGATGGGCGTCGTCGCGATTATGTTCCTTAGCTCCACGAACGTGTGCTGCACCGAGGCTCCACCTTTTCCAAGTTCTCT
TCCGTCGTCTCTTTCCACATTGGATCCTCTTTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGTCGTCGTACTACTTGGATCCC
TTCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTTAATTTATATAG
TACCGCAGCATACAGTGCGTAATCCTCGATGAACCGACGGTAGTAGTTCAAACTGCCCAAGAGGGCTTGCATCGCCTGTAACGACCGTGGGAAGGACAAG
TCCGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCTCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTTTTCA
CCACGCTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATCTCGCCGGGATTAGAATGTCGTC
GATGTAAGATCTGTGTCCTAACACAGACGGGTTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCC
TTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCC
ACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTA
CCAGAGTACTTTATCCAGATTTTCCAACAGCTCATTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCAC
AGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGAGATGCCCACGGGGACGTTGAGAAGCGGATGATCTTGGCTTGCAATAGGCCCTTAA
TCAGATCCGATAGTTTTTCTCGGAACTGGTGG