Description :
From Genome Similarity Track
Location :
Scaffold_1553:8- 1618
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1553-fgenesh-gene-0.0U3 snoRNP-associated protein Utp7

Sequence
1610 bases(100 bases per row)
AGCGTCGTGCTGGCCCACGCCACGAAGCGCCAGCCGGCGGGCAGGCGGAACGCGAGCCACCATTTGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTGGTCGCCGAGGTTGTGGAGCGCGCCCGCGACGTCGGCCGCCAGCAGCGAGAACGTGACGTCGGCCACGCTGTTGGGCGTCGTGGG
CGTCACTTGCACTTTGTAGGAGCTTGTGGACACGCACTTGCTGAAGCCGGCGGGACACGCGCCGTTGGCGAGCTGCGGCGCGCAGATGTTGGCGAGCGAG
TCGCCCGGGAACTCGTGCTGGCACTCGCTGGCCTGGCAGCGGCAGTACATGGAGCGGTACGGCGTCTCCACGGCGGGCGTCAGCGCCACAGTGTCACTCG
GATCCATGGAGGAGGACGACGCGGTCAGCGACAGCGTCGACGCCTCGACGGTCGCGACGGAAGACCCCTCCTCGCCGGCGTTGGCAAACGTCGTCACGGA
CGCCGGCTGGACCGTGGGCGTGGGCGTTGGCGACGCGACGCTGCTGAACGACACGGCCGCGCTCTCCAACTCGGGCGCGTGGACCACCTTCTTGCTGCCG
TGGTCCTTCTCTGGCTTGGGGGTGAGCGTAGGTGTCGACGTCGACGTCGTTGGCGATGGCAATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGTCGTCGTCGGCGCTGGCGCTGGCACCGTCCGTTTGCTGGCCACCAGAGAAACCCTC
TCGAGCGATTGGGATCCGTGCGTGGCGCCGTCCGTGAAGTCGCGAATCTCGTCGTCGCCAACAGTCACTCCGCCGCCCGAGCCCGAAGAGGACCCAGAGC
CCGACGACGACCCGGACGACGAGGACGAGGAGGAGCCATGGGCCACGGCTTCCTGCGTCTGCGGGCGCTGTCTTCCCCTGTGCGAAATCCGCGAAAACCA
ATAAAGCGGCGCGTCGCCAACGGTTTCTGTTGGTTTTTTGCTGTCAGTCTGTTGGTTTGTTGGCGCCGCGTGGGCCAATGGCGCGGCCGCCGCCAGCGCA
ACAAGCGCAGCGACGACGGCGAAGGCGGCCCAGCGCCGACGCATGAGGCTCACTGGCGTTGGTTCTCCTCTAGGAGACCGTCGGGAGCGTCGCGGACTCC
CCATGGTGGTGCTTGGGCTTGCTTATTGCGCCGCCCTTGGTGAGAATGGGCCGAGCGAGTCGGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACAATCCCAACGACAAGCTGACGATCACGTGCCCTGTTGTTCACTCTACAACCGCATGCTGACTTGGAAGGGTTCATCAGACCCCTAACCCG
CATGGAAACGCAATTGTGTTCTTTTATTGTAATATTTGATGGAAAAAATCCCAAAAGCATGGCAAATGTCAGGAAACAACGATGCCCTCAATTGAAGACC
CTTCAAAAGAGACTTCTATTCAGGTAGTGAACAGTACCCAGAGGTATGTTGCCTCTTATGTTCCATTGGCCACGGTGCACCACCGCAGCCGCCGCCAAGA
GCTCTTCGCC