Description :
From Genome Similarity Track
Location :
Scaffold_2926:8- 1576
Transcript NameFunction/comments
Phyta_totarag14940hypothetical protein

Sequence
1568 bases(100 bases per row)
TCGTTGATCTTTTCCGCAACGCGAAAAGGGCCATGCCACAGATGGGCTAACTTCCGGGCGTAGCCTTCCTTCACTCGATCCAGATATAGCCACACTTGAG
ATCCAGCTCCGATCGAGTGCGGTCGAACTCCTTCGTTGTGCCGATGGGCTCGATCTGAGATCGCGCCTCGCAGTCGGTCATTAACCTGTTCTCGGGCTTG
CGTGAAGTGTCGTTGGATCCGATATCGCCACCTCCGGGGATCGTGATCCTGTGTTCGGGTGCACCTCAGTGGTATAGTCGCCTCGAGTGTCGATCGCGGA
TCCCATCCGTGAACCAGATAGAAGGGTGtatctccacgaactcgatCTTGAGCTGTGTTGATCGCGAACGTTAGTCGCTCCGCATACTCATCCCAATCTC
GTTGATCTAGGTCCTGAACGAACATCTTCAaagctctcgtcgtcgtctgtaCCATTCGTTCTGCCGTACCGTTAGCCTGAGGTAGGTACGCCATAGTGGC
CCGCTGACGCTGCCTGATGATCTTGTTAAACGCGCGGAAGAAGTCCAACATGAATCCGGGTTCCCGATCGTGTCGAATTGCCTCACATGCTCCAAACCTC
GGAAGACACACTCTTCATAGGATTCGGCGATCGTTTGCGCCGTCCGAGACGCGCTAGCTTTGGCGATCACGTACCCCGTGAACAGATCGACCCAAATCAG
CAGCTCTGTGTTGCCTTTGTACGACTTGGGTAGCGACGGTATGTGCTCCATCGCGATGATCTGGAACGGATACGTGGATTGGATGTTCAAGGCGATTCGC
CCCTGATCGTTGTCCGTCCCTTGCCAGTTTCACAGTCAACACATTCGCCGACATACTTCTGCACGCTCTGATATAGACCCCTCCAGTGGAAGTGATCCCG
GACCCGCTGATAGGTACGCCCGATCCCTCGATGACCTCTTCCAGACTGGTGTGGTAATGGTGCAGGATGGCTTGGTGTAGCGTCTCTGGTGCAACCAGCC
TCATCAATCCGTCGCGATCGGCTTCGGATCTCTTGGTAGGCGGGCAGTAGAACAACCGATCATGGCCATCCACCTCATAGTCAGCCGCAATATTGCCGAG
AGATCTAGCTTCGTCTTGCGTCAGGTTCACCACATCTCCTGCCAAGTACTTCTTCATACTCGAGATCCACGCTTCCTCATCCAGTGCCTTTCGGATCCGA
TCGATCTGCAGCCCACGGGCAAATTCTTCTTGCATGACCGTTGGGTTTGATCTGGATCGAGCACAGGACCGAGTAGCCACTGGCGAGATCCGGACGACTG
GATCATTGGATCCGACTACCAGAATCTCGTCGAGTCAATTCAACGTAATCAGGTCTTGGCGATCCGCTTCACTCTTAATGTCGATCCCTCCCAGACGTTG
GAGAACTGCGCTTGCCAGGCTATCCACGCTACCATTCCAGTCAAGTTTAACATGTAGTAGCTCGTGATCTGGCCAGATCCGCAGCAGATCTAAAGCCTTC
TGCTTTAATAATGTCAGCCCGGGTGCCTTGCAGTCGATCTCTCCTCTCACTTGCCGAATCACTAGATN