Description :
From Genome Similarity Track
Location :
Scaffold_3177:8- 1505
Sequence
1497 bases(100 bases per row)
ATCGCTACGGATTATTCAGTGGATCTGAATGATTTGCTCTTCTATTGTCCCTTACGAAAAGAGTCAGCGAGGATCGGGACGGATTGATGAGATTGGTGAT
GCCGGAAGCCTTGCAACAGGATGTCCTACATCACTGTCACGCTAGTTTAGAAGGTGGACATCAGAAAATTGGTCGGACCTACCAACGGATCCGAGAATGC
TACCACTGGAGAAGACTATTCAAGAGTGGGCAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGACCCACAATCGAAGGGGGGTCTC
CAGGGAATGTCCAGGTGACTTACCCGTTCCAAATCATAGCCATGGATCCCATCCCCTCGTACCCAAGTCATTCAAAGGAAACACAGAACTGTTGATCTGG
GTGGATCTGTTTACCGGAAACGTGATAGCCAAAGCTAGCGCGTCCTGAACTGCGTAAACCATCGCCGAATCGTATGAGGAGTGTGGTTTTCGAAAATTTG
GGGCTAGTGAGATGATTAGACATGATCGGGAACCAGGCTTCATGTCTGATTTCTTTCGAGCCTTCAACCGAATCTTGGGACAAAGACAGCGGGCAACTAT
GGCATATCGTCTTTAAGCCAATGAATCGGCGGAACGTATGGTACAGACGATCACGAGGGCGCGCAAGATGTATGTTCAGGATTTGGATCAGAGGGATTGG
GATGAGTACGCAGAACGACTCACCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCATTTTACTTAGTGCATGGGTGGGATCCTAAAT
CCACCCTAGAAACGGCCATCCCGGTATGTAGCACCAAGAAGAGGAACCCAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAG
ATCCCAAATGAACGAACGGCTGCGAAGTGCGATACAGGATCCAGCGGATCGACACAACGAAGCCGCCCGTCCACGTCAAATCCAAGGTGGATCGCAGGTA
TGGCTGTACTTAGATCGAGTGAAGAAGGATACGCCCGCAAATTGGCCCATCTCTGGCATGGACCGTTCCGAGTAAGCGAGAAGATAGGGGAGCACGCTGT
GAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTACCCCGTGGTACATGTATCCAAGCTGAAGCTGGTCAAGGAATATCTGGACCGACCGCAAATCCGT
CTTTCGGTGGATGAGCCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGGGA
AGATCGCCAACATGAGGTCAGGGATGCGAACTAGATTTGGACGAATTTACAGCGAATTTCTGGTGTATTGGCGTGATATGTCGAGCTCAGTTGGGAAGAC
GTGGCAGATCTGAGCTGTGGAGCATTACGCTATGATTTCTTGCGGGACCGTACGAATCGGAAGAGATTCGGCGTGATGCAGTCTTGTGGTGTAGCGG