Description :
From Genome Similarity Track
Location :
Scaffold_1922:8- 1491
Transcript NameFunction/comments
Physo_126918Os02g0712000

Sequence
1483 bases(100 bases per row)
CTTCCTTCTACCTGCCCCTAGATCGTGTAAAGAGAGCGTTCGATTTAATCAGAGAGGGTAAGGACGTGCCTCGAGGCACCATCCAAACGATCTTCAACTA
CAAACCCTTCGACGAGGTGCGCCGACTTGGCGTAGACCCCGCCACCGAAAGACTTGTTCGCTCCTCCTTCCCGTTGGCGACAGGTATGTTGACGGTAGCT
GAAACGATCCCGGGCGGCCCATCGAGCAGCAAGTTGCAGCCAGGCGACGTGCTGATTCGCGTTAACGGTGAACTGATCACGCGCTTTGTCCCGTTGGAAG
CCATTCTCGACGAAAACGTCAGCGAAGAGGTACGTTTTTTTTCATTTTAGGGCCTGTGAGATTGAAAGCATGGCTAACCGGTCAAGTGAAATTTGGGTAG
ATCGAGCTTCAAATTGAGCGATCCGGCGAGTTGGTGACGCACAAGCTACAAGTGCAAGACCTGCACGCCGTTACTCCGTCGCGTTTTATTGAGATCGGCG
GTGCGGTGATTAACCCACTTTCGTATCAACAAGCACGAAATCATGCAATGAGCCCTGGAGCGCCGTACGTGGCGGACCCGGGTTACTTCCTGCAGCGTTC
TCGCATCGGCCGCGGCGCTATCATCCACTCGGTGAATGGGATTAAGACACCCGATCTCGAGACGCTTAAGAACTATTTGAAGCAGTGCAAGGACCGGGAT
CGCATCGTGGTCAAATTCTCGAAGCTGACGGATAAGCCGGAGAAGGTCGAGGTCGTGCATGTGGATCGGAGGTGGTTCCCATTCTGCGAGTACGTGCGCG
ATGATAAGCTCGGCACGTGGCATTGCGAGCACTTCGCCCCGCCCGCTGAAAGCACGGGTACAGATGCCAAGCCTTCTGGAGAAAAAGAACCGATTGGATC
GACAACGACACTGCCTGGTAAGAACCCGGTGGAGAACAAGCTAGCGCGCTCGCTAGTAACCGTGGACTTTGATCGCCCATTTAGCGTGAACAGCTTGTCA
ACATCGAACTACCGTGGCACAGGACTTGTGATCGATGCGGAAAAGGGACTCGTGGTGGTGGATCGCAACACCGTCACTGACTCGATGGGTGATGCTATGG
TAACCTTCGCCAGCACTATCATGGTTCCAGCGCATGTGGTTTTCGTGCATCCGGTGCATAACTTTGCCATTGTACAGTACGACCCCAAGCTCATTGGGTC
AACCCCTATTGAAAGTTGTCAAGTGGCATCCAAGCCGTTGGTACCCTCCGATCCGGTGTGGCTCGTGGGTCTCATGAGCAGTGTGGGGCGCAGCGGCCAC
TCGGATCTCGTATCCCGGGAGACCATCGTATCTGGCGTCAAGTGGATTGGGTTGCCCATGCCCAACCCACCTCGGTATCAGGAACACAATCTTGAAATGG
TGGCTTTGCAGGATGTCGTTGGAACTGAAGGCGGAGTTGTATGCAGTGATAAGGGCGAGGTGAGTGCTTTTTGGGCTTCGTTC