Description :
From Genome Similarity Track
Location :
Scaffold_197:8- 1408
Sequence
1400 bases(100 bases per row)
ATCCCCGGGCGTAGTGACCGATGTTTCCCAGCGGAAACAACGCACACTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCC
ATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCA
TTGCGAGCGCAATGGTAGCTTCGAGAGTATTGGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTT
TGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCAAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGG
AACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTCTGAGCTCCTCCTTGAACTCTTCGTACGTGATGAAGCACGTAGGGTCCGTGA
GTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCTATGGC
AGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTCGCCATC
GGCCACACCGAAGTTCGAGCAGCGGTTTTACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCG
TTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCATTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGC
AGACGTGTTTGGGCTACCCACAGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGG
ACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTGATTTACTTA
AGTTCAGTATACTTGTATCCGCAAGTATACTTAAACTAAGACAAAGGGACCGAACAATAGCTTTGGTGCTGAATGAGAACTGTATTGATTGTAAATGGGG
TTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAGCCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTAC
TTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCCGAATGTATTCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG