Description :
From Genome Similarity Track
Location :
Scaffold_2436:8- 1320
Transcript NameFunction/comments
Phymu_g14118hypothetical protein PHYSODRAFT_335121

Sequence
1312 bases(100 bases per row)
TGATCTGGAACGGATACGTCGCCTGCAGATTTCCCGGGGATTCACCCTGGATCGTAGGTCTCTCTTTTCCGGTCTCGCAGTCTACACATTCTCCCACATA
TTTCTGCACACTCCGATATAGGCCCCTCCAGTGGAAACGAACTCGGATCCGCTGGTAGGTGCGACCAATTCCTTGGTGGCCCCCTTCTAAGGTAGTGTGA
TAGTGATGTAGGATATCTCGCTGGAGAGTTTCTGGAACGACCAATCTCATCAATCCATCTAGATCGTCGTTCGATCTCGTCGTAGGGGGACAGTAGAAGA
GTAGATCATGTTCGTCCACCTCGTAATCTGCAGCGATCTTGCCGTAGGATCGAGATTCAGCCTGACTGAGATCTGCGATCTCCCCGATCAGATACTTCTT
CATTCCTGCGATCCATACCTCCTCGTCTTGCGCTCGCCTGATCCGATCGATTCGCATTTCTCGGATCAAATCCTCTTGGTGGACAGCGGGGTTGGATCGT
GCACGAGTAGCAGCCCGTGTAGCTACAGCTGAGACCCGTACCACCGGATCTTCGATCTTGGGTACCAGAATCTCGTCCAGTCGATTCAGGGTGACTAGAT
CCTGCCAATCCGCCTCCTTATCAACCTCGATCCCGCCTTGCCGCTGAAGAGCGGCGCTCGCCAAGCTGTCGGCGCTCCCATTCCAGTCACGTTTTACGTG
TACCAACTCGTGATCGCCCCACTTCCTCAGGCGATCAAggaccttctgcttcagtaATGTCAATCCCGGGGCCTTGCAATCGATCTCACCTCGGACTTGT
CTGATCACGAGGTTGGAGTCACCACAGATCACCAAACGTCGTCGATTGAGGTCGCTCAGCAATTCCAGACCTAGTAACAGACCGTTGTACTCGGCTTCAT
TCACCGTAAGACTCTCGGTATAGCTTGATCTAGCTTTGATCACCTTCCAACCGGGCAGACTCCACACGATCGCGCTGTAGGCTCCCCCGCCCCGCTTCAC
ACGAGCCGATCCGTCAAAACTGATAACCCACAGTTCTTCATCACGATCCACTGTAGGGATCGGTGCCTGAATACGACGTTTGGGCTCCTTCTGAGGTGCG
ATCGCGATCAGAGCTTCGTCGATCTTGGATCTGGGCGTGATGCTGGCGGCGATCGCCCCCAGTATTTCGTCTTCCCCTTTCGAGCATTTCGTGATCTCGA
GCGCCCATCGTGACAGGAGTGCTGACCACTGACCCAACCGACCTTGGAGCCCCGCCGACTTGAACAACCAGGAAAACGTAGAATGTCGAGTCAGGACCTT
GATCTCACGTCC