Description :
From Genome Similarity Track
Location :
Scaffold_1521:8- 1264
Sequence
1256 bases(100 bases per row)
GGCACTGCGCAGGGAATCCCCGCCTCAAGTGCCTCGCCGTGCAAGCGATCTAACTTGCCTCGATTCGACAACTTCTCGAAACGCTCATGTGATGTGGTAA
TCCAAGCATGATACCCAATAGGGTCTTTGTTGAGTTTTCAACCAAGGCATTCCAGCTTTGGCAAGTGCTTGCCACTCGGACACTTTGCTTTTGTGAGaag
tcttcttgctcgcgtagtgtcggagctcatggaaGAGCCCGACATAATAGTCGCGCCTTTGATACCTTGACGGTTGAAAGCTTTTGGTATTTGCCACGGC
ATCATCATTGATGCCGTTGACCGCGTACAACGGTCACCTGTTGGGCGGCACACTAGCGCCCACCCGATCGATCATCTCGGATGCAGTTGGCATCCATGGG
CCGCGCACTGTAGTGTCAGTGCTCGGTGACGAAAGCGTTCTCGTTGCGACGAGCGCTGTCACACCTTCACTTCGCGAGCACTTCGGGCTTAAAGCGTTCG
AATCATCTTTGAGAAGGCGGTATGAAGGTCGCACAGAACAATAGCTGAGGACGTGGCGTTCTTTCGCTCTGAAGACGATATTTTCTCGTCTTCTATCTCT
TGACTCTCTTCCTCTGAATAAAATTCATAGTCTGCTGGAATGTCGGAGCCTCCGTCAGCAGAGCCTCTCGAAGAACCAACGAGGACAGCCTTTGGCTTGT
CTGCTCCGAAAAAGCTTCACcacttctgcttctgcagagcGTGTTAACCAGCGACACAGAGAGGTTACCTTCTGTCGCGGCACGCGGCGTTGTCGGCGTG
GGCGagttacacgtacaagtggctacatcacttgtaacctaacagaagtggctttTGTTAGAAGTCAGGGACCGCCTACCTTGGTGTGTGGTACACTTAT
GTCTACATTCAGGTGGATGACTGGTCCGCATTCATTTAGAaatctcattggtagaaagcagcatatCTCTATTAATTAGAATCATATTATTCGGCAGACT
ACCCGTCGGCAGACCTCTATTACATGATATCACATTTAGGAGGAAACCCAAGCAATAGGCtaaatattaatacatttCTCAATTCCACATAAAGTGTTCA
TTACCTTTCTTTTATCTAGCTgtaattatacttgcagctcgcaagtataataaagttaagttAAACAAACCAtcgcttcctcatacacgtgcgcaccCAT
GTAAGCTGTAGTagtgggctaagtaggcccattacacaGCTCCAACAGAAGTTGCA