Description :
From Genome Similarity Track
Location :
Scaffold_2546:8- 1229
Transcript NameFunction/comments
Phypl_g15187reverse transcriptase

Sequence
1221 bases(100 bases per row)
AGGCGAGTCGCCGGGGAATATCGTCGCGACCTACCCGTTCCAAGTCCTGGTGATGGATCACATCCCGTCCTTGCCCGCGTCGTACAAGGGCAACActgag
ctgctcgtctgGGTGGACCTGTTCACAGGGTTCGTCATCGCAAAGGCAAACTCGTCACGAACAGCGCAAACGGTGGCCGAAGCGTACGAAGAAGCCGTCT
TCCGACGGTTTGGCGCGAGTGAAGCGATCAGGCACGACTGGGAGCCAGGTTTCATGTTCGATTTTTTCAAAGCGTTCAGCAAGCTGATGGGCCAGCGGCA
ACGGGCGACACTCGCCTACCGACCGCAAGCGaacggcgctgcagaacgcaTGGTGCAGACGATCACGAGAGCGATTAAGATGTACATCGAGGACATTGAC
CAGCGCGACTGGGACGAGTACGCGGAGAGGCTCACCTTCGCGTTGAACACGGCCCACGATCGTACGAGGAATGAAAACCCCTTCTACCTTGTGCACGGAT
GGGACCCGAGGTCGACACTGGAAGCGACGCTGTCCGTCGGCAACACGTCTCAACGCGAGGCTGaggccaggcgctggcgatTGCGGATCCAGAGGCACTA
CAAGAtcgcgcgagctcaagcgtTGGAGTTAGTCCGAGAGCAGTCGAAGCGAGAGCACGACAGCAGAACAAGATCGCGACGGAACACGTGATTGAGGCCG
GAGGGCGAGTGTGGCTTTACCTGGATCGAGTGAAGCCGGGGTACGCGCGCAAGCTTGCACACATGTGGCATGGGCCGTtccgcgtcgtcgagctggtgga
cacgTACGCCGCGCGACTTGAGACCAACGGTACGCGCTATCAGCTCTACCCGATCGTGCACatctccaagttgaagcccgTCCGGGAGTTCCCGGCGCGC
CCGGCGATACCGCTGACGGTGCCGGTCGGTGAGAGTTTCGATTTCGGTGAAGAGCTCTTGCCCGATGACAGCTGGGAAGCGGAGGAGTTGGATAATGACA
CCTTCGAGGTCGAAGAGATCCTGGACATGCGCGAGGGCCGAGCCACGCGATATAGCTGTACGCGGCGCGAGTTCGAAGTGAGGTGAAAGGGCTACCCCGA
CACGACGTGGGTCGATGAGCTGGACCTCAACTGCGGTGGAGTGCTGTACGACTTCTTGAGACAGCGCACGGGGCGCAACCGGTTCGGCGTGATGCAATCG
CGCgagaacgcggcggcggag