Description :
From Genome Similarity Track
Location :
Scaffold_4396:8- 1203
Sequence
1195 bases(100 bases per row)
CCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTACGGAAAACGCACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGCAC
TAGCTTTGGCTATCACGTATCCGGTAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGAGCAGCGAGGGGATATGATCCATGGC
TATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACA
TATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCAT
GGTAGTGGTGTAGGCCATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAA
GAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTC
TTTAGTCCCAAGATCCACGCTTCCTCGTTTGGTACTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATC
CAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGAACTGTCCTTTTCCCGGATCCCACAACCACCACTTCGTCTAGTCGGCTCAACGTAACGAGATC
CTGATGCTCGGCCTTTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGC
ACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTC
TGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATT
GACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAATAGGTGCACTGTATGCTCCTCCTCCGCGT