Description :
From Genome Similarity Track
Location :
Scaffold_3989:8- 1154
Transcript NameFunction/comments
Phypl_g16124Rab7 family GTPase putative

Sequence
1146 bases(100 bases per row)
GTATTGCGCAAATGTTGCACTAACGAGTAAGGCTAACCTCGAATGGAtggcgctctgctgcagtgAATGGCGCTCTCCGCAGCGTGTCGTTCACCATTTC
ACCTCCTAAGGCTGCCGTGGggcgccaccgccaccagtACTCCCACGACTTGCGCGTGCTTTGCGTGCAGAAGCACCAACGCGGGCTTGGCTACACGAAG
ATCAGCAAGATGCTTGAGACGCCACGTGGATCTGTCCGCAACATCGTCAAGTACTACAAGAGGCACGGGCATTCCGTCGTCTCAACTCGCTCAGGTCGCA
AGAAGATTACCGATGTACGCCAGGACAGTTGAATTGTTCGTGCAGTCGAGGAGAATCGCTTCATTAGCGCTGCTAAGTTGTCTGCCTCGGTAGAGGCAGA
TATTGGAAGGAAGATTTCACCGTGGACGATCCGTTCTCGGAttcacgctgcaggactTAACGGCCGCTCCGCCAGGAAAAAGCCATACCTGTCGAAAAAG
CACCGCCGTGCCCGACCAGCCTACGCTAGGAAGTATGGTCACCTCACTGCTGAGGAGTGGGACGATGTACTGTTTACTGACGAGGCCAACGTTGAGCTCC
ACGGGACGACCGGTCGTGCATCGGTGCGGCGCAGGACCCACGATGCCTTCTCCGACAAGTGGGTGCTGCCAACGTTCAAGAGTGGCCGCCAATCCGTCAT
GGTGTGGGGGTCCATTTGCGGTACCGTCGTCGGAACGCTGCACATTTGCTCGGAAAGTGTGACGGGGGAGTACTATCGTCACATTCTCCGTTCTGAGGTT
CCAATTACGAGGCTACTGAATGGTTTACCGGCGGCAACCTCTTTTGTTCAGGACAATGCCCCTGCGCACCGCACCAAGCTGACGAAGACATGCATCAAGG
ATCTAAACCTGAAGGACTTGGGGCATCCTGCCCAAAGCCCAGACCTCAACCCCATAGAGAACGTCTGGACTGCGATGAAACGCGAGCTGAATCGAGCCCC
AGCATCCTCactcgacgacttcaagctcaagctcaagagTATCTGGGCTGGCCTTAATGATGGTCTGATTAAGAAGTGCGTGCGCTTCATGTCAAAGCGT
CTGGACGCAGTGAAGAAGTAGCGTGGGGGTCACGCTAAATATTAGG