Description :
From Genome Similarity Track
Location :
Scaffold_1743:8- 1088
Transcript NameFunction/comments

Sequence
1080 bases(100 bases per row)
CTGAAGATAATACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCACCGGTACCGTCGCATCGTTTAGCTTATTGTAAGCAT
GAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACATAACGTGGGCGCGCTGTGCGGGGACTTAGATTTCCACCCTTGTCCTGCCTTGCGACGACGTTC
AAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGTCACTGTCGCGTAACGCAATACTTTGCTCCCGGCACGAGATCAATCTCGTGCTGAACA
CCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGCCCGGGAGTACATCCTTGTACTCACGCAAGACATTGTAAAAGGGACTCGATTTGAGCGAGTCCCAGC
CTTGCTCGTCGAACCGTTCCTTCTTCGACTTCGCGCTGAGGGTCTCCGCGCCCTCAGTGATGAGCTGCTTCAGCTCTTCTGCTGCACACGTCATCCTCTC
GACATCCGAGAAGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCGACTCCGACGCT
AACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAGGGTCTCGACGCTTGTCTCCAACTCCTGTG
TCTGTTCGGCAGACACTGCTTGTAGCGTCTAGGTCCCTGATTGGGACCTGCACAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCC
GCGAGTTTCTTCTTGTCCAGGCCCGACCGTGGTAAGATATTCCTTGTATCTGCTGGCGAGTTCTACCCGCGGGCGCACGTGTTCAAGCCCGGCTTGATCG
CGTACCTCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAATCGTCCGCACTGCTTGTAGCGTCGGCTCACA
GAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGAC