Description :
From Genome Similarity Track
Location :
Scaffold_260:8- 1087
Sequence
1079 bases(100 bases per row)
CCTGATCGAAAGATCATTCGCTTCAAAGGCGCCAGCCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTGTCCGCC
ACTCGGGGGGCCGAGATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCA
AGTGATACTGACGATCCAGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATTTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCCTCACAAT
CTGGTCCTTGTCCGCGATCGCGTCCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGTCTGATCCCGCCTTAGTTTGTTTTGTT
AGTGAATCTCGGTTCGCACCAAGATCCACCGGGGTCCCCGAAGGGACCTGTGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGA
TTCCGTCGACAGAAGTCCTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTTGATCCGATATCCGACGACGCCTCTTCCCC
TGGTTCTTTCTTCACTTGCGCATCTTCTACGGACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCACACCATTGTGGTGTAGCGGGATCGGCCAAA
ATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACC
TTGTGTACCCGTCGGCGGGCTGGATATGCTCTCTCGGGGCTCCGAAGATGCAGAACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGT
GGGGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGT
CGCTTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA