Description :
From Genome Similarity Track
Location :
Scaffold_4132:8- 1065
Transcript NameFunction/comments
Phypl_g16182reverse transcriptase

Sequence
1057 bases(100 bases per row)
ACGGTGGACGCTctgttggagctggacgagatgtcCATTGCCGAGTTCGGCAACGCCTTGAAGGCTGGCGAGTTAGCCGAGTTGGTCATTATACGACCTG
AGGAGGAGTTaaactcgtcgtcgcttttGGATAAAGCAGTTCTTGAGGAcaccaagaaggcgctgaatGCGCGGGCAGGATCCTCGATCCTCAAGGACCC
CTCGGATCCGTACTATCCTTTGGTGAAGGAGTATCAAGACGTGGTCTCGAAAGAACCTCCCACGAGGCTACCTCCGGATCGAGGTGTACGTCATGAGATT
GACCTGGTTCCCGGAACCAAATACTGCGTGACAAGGCAGTGGCCTTTGTCACGGGAGCAGTGTGACGTCATTGACGCGTTCTTCTGTGCCAAGCACGAGG
CGGGTATAGTGCGTGAGAGCAAGTCTCCGCACTCAACGCCTACGTTCTGTGTCAGAAAGTCGAATGGCAAGTGGCGTATCGTTCACGCTTTCAATAAGCT
TAACGCGGCCACTATTCCGGCGCAGACGCCTATTACTAGGAAGGACGTTCTCCAGAACAACATGACGGAGTGTACGGTGTACAGTGCCCTCGACTTGGTC
GATGGATACTATCAATTGCTCATGAGAGCAAGCGATATTCCGCTTACAGCGGTCAGCACTCCGAGCGGTATGCTNGTGGAGAACCACATTGAGCACCTGC
GAGCAGTGCTCGAGTGCATGCGCACACACAAGTTGTATGCCAACATCGACAAGTGTGTCTTCGGCGCCGAAGAGATTCCCTTTCTGGGATGCTTGATTGG
GAAGCGAGGCCTTCGAGCGGATCCCGCTAAGGTCAAGGCCATCGTAGACTGGCCGGTTCCAAAGAACCAGAAGGACTTACGGAAGTGGGTTGGCTTGGTC
AACTACAGCAGGAATTATGCTGAGGTGGCAAGGCCACTGTCCAATCTCCTTAAGAAGGATGTGGACTGGTGTTGGGACACCGGGCATCAAGCGGCTCTTG
AAGCCATTAAGGAGAGTCTCCTTCAGGCGCCGATCCTGGCACTGCCAGATCCCGATC