Description :
From Genome Similarity Track
Location :
Scaffold_893:8- 1039
Sequence
1031 bases(100 bases per row)
CGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAACTTGAAGACGCCACCTCACGCGGGGAGCTTAAAGCCCCAGC
AGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCCGAATCGTCTCCTTCACGAGGGCGTCTCGACCCGGCA
TGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCACTTGCTAGAAGAGGCTTCGCCCTCTTCCATCTCCACGTCGCCGTCCTCGTCGTCAACGGCGT
CGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGGCTGGGTTGTCCCCGACGCGGCCTTTGCAGCGAGCGCGTCGCGCTTTGCCTGCTGGCACTCATG
GTACTGAGCAACAGAGAGGCTACCCTCTGTTGCGGCGGCTGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGA
AGAATTGACGAATGGTCAATTTCCTGATTGACGTGCTGTGACTCGGCGCGTCTAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTA
CAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAGGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACC
ACCACGATGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACC
AGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAACATTATTTGG
ATCGTTTATTTAGATTATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCT
AAAGTAGTGAGCCAAAGTAGGCCCACTACAC