Description :
From Genome Similarity Track
Location :
Scaffold_4153:8- 1010
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_4153-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
1002 bases(100 bases per row)
TGGTGAGCTGTTGCTGATTACGGGAACATCGGCTGCGGAGAGCAAGATGCTGCTCGAGTGCATTGGCGGACGCAACGCGAGTGTACAAGGCAGCATCGGT
ATGAACGGCATGCTGTGGACCCGCAAGATGAAGCGTTACATCTCGTACGTAGTCGAAGAAGACTTGTTCTACGAGACGATCACTGTGCGCGAGCACTTGA
TTTTCCAGGCTCGTCTGCGACTCGGCAAGTCGTTCACTGAAGAACAGTACATGCTGCGCGTGGACGAGATCATCGAAGAAGTTGGTTTGATGCACCGCCG
AGACGCGTTGATCGGAGGTATGTTCGGCTGGGAGCGAAAGCTTTTGTCGATTGCGACGGAGATGCTGTCGAACCCATCGATCCTGCTGGTAGAAGAGCCA
GCGTCCGGCTTGGACAGTTTGTCGGCGGAGATCGTGATGTCGAAGCTGCAGCAGATTGCTCGAAGTGGCCGAACGGTCATTGTGACGGTGCACCAGCCAA
CGTCGGAAGTGTTCGGGTTGGCGGATAGCCTGTATTTGCTTTCGGAAGGTACGGCTGTGTTCTACGGCAAGGCATCGGAGGCGAACGGATACTTTGCCTC
GCTTGGATACGAATGTCCGTCGTACTCGAGCCAAATCGGCTACTACCTTCGTTTGTTGATTGTTCAGAGTCGCGAGACGGACCATGCTGGTGCGGCTCGA
TTGGCGATGCTGAAGGAAGAGTGGGCGAAGCGCGAAGCAGCTATCGTTGTGGAAGAGACTGCATTCGAAGTTGGTCCAGCTGACGATGGTGTGAATGCTG
ACGCTGAAATCAGTCTCGGCTTTTTCGGTCAACTGTACGTGCTCATCACTCGCAATGTGATTCGCTTGATTCGCTACCGCTGGTGGTTCTTCTGGATGAT
TATCTGGTTCCTCGTGATCGCTGTGATCTTCGGCTTGATTTACTTGAACCTTGACATGACGCAGCGCGGCATCCAGAATACCTCGGGCGCATTCTTCTAC
AT