Description :
From Genome Similarity Track
Location :
contig_11:79990- 86596
Transcript NameFunction/comments
g2550.t1hypothetical protein
g2551.t1hypothetical protein L914_03019
g2552.t1hypothetical protein PHYSODRAFT_539927
g2553.t1hypothetical protein F441_03152

Sequence
6606 bases(100 bases per row)
TGGATGCAGGATCATTCGCGCATACTGTGGAAAGTGCGCCTGACGAGGCCAGTCGCTTGAAGATCGCAGATTTGTACATGCACGCCAAGGAGCATGAGCT
CATTTACACAACGCAGGACACAAAAGAGCAGCATCATCAATTATCTGCTGCTTCACGCCGTACTGGATGGCAATTTCAAACACATGATGGAACTCCTGCA
CGAGATGCAGTTATATAACAATCGGCAAGCAACCGGACGGTCCGTGAACTTTTCAAAAGTATCGCGCAGTATCGAGCACAAATTCGGCACCCGCAGTTGG
CGGCCATGCACAACGTGGGAGGTGGCACAAATGATTCCGTCAGGAAACTGGCCGAATGCCCAACGATTATGGAGCTCTTTGAAAGGTTTCCGAACGTCAT
TTCACCCACGGTGTATTCGTTCTCCCAAGGAATTCTCCAGAGTCTGTATGCTGGAGACCTGGCCGTAGCGCTTGATCTCATGCGTGCAGCTCTGTGGGCG
AAGGATGTTACGCTCCGTCCAGAAATATACTCCCAGCTGCTCTACCCCTTGCTAGCAGGCGGGCAGCGCGGCGGAGACGAATTCAGCGATGCCAGTGTGT
TTGACCGCCTGGAGGTGGAGCGCTGCTTTGATCGACAACATCCGAAGAGCCGCGTTCTCTTGAACTCGCTTGTCGTGAACATTTGCCAGTCCAATGACGA
CTTGTCTACGATGCTGGTGTGTCTGGACCGCTGGCAGGGACAGAGACACCCACCGATGAGTCGGCGATTAGTGAAAGCGCGTGTTCGAGGTGATCTCAAA
GCAGATCCAGCGGCTTCAGAAGGGAAGTGACAAAGATACTCGTGGAACTGCGTTCATTGTGGACGGGATGCAGTTGTCATATTTGGCGTTCATGTTGCGT
TATCGTCGCATCATCGTGTGCGACGCGTGGACGCTTGAGCGCGCTATCGTTCGAGCTCGTACTTGTGGATTGCACGCCGACGTGGCGGCGTTGCTGGCAG
AAGCCGACGCTGGTGACCTTGTACTGAACAGCGCAGCGTACATTGTGTCGCTCAGCGTGCTAGAAGAGGAAGGCGAACCTTCCGCCGTGGTGGCTTGTGT
AGAGAAGATGAAAGCCAACGGTGCGTGGGAATATGCTGTGAGCAAGGACCCGGAGGTGCAGCAGATTTTGAATCGAGCCTCCACCAAGCTGGAAGAGGAA
ACTCAGGAGCTGGAGACAGATCCTACCGAATAGATCAGGCGGCAGACGTTCGTCAGAGGACAGCAAAGCACTGTCGAAGTGTCCTGCAGTGTCCTCGGCG
CTCATCTAGGCAATAACTATTACTGCGAATTTTTCCCACTTCAAGTTGCTCAGCTCATCTCATGCTTGGAGCGTCTCCGCAATCTCCTGCCCAGTCGGCA
TTTGTCTCCGTGGAACAGAGCTCCGATGGCCGAGATCAACTACGCCCTAATGCAGCAAGGCTTGCAGACGGCTGAGGCCAAGCGCGCGCGCCAGCGTATG
TACGTCAAGACCAGCTACTACCGGCAGCAGGTAGGCAGAAGCCCAAGAGCCTATCGTCCTTATTGTAGCTAACACTATTTGATACGTGTGCGTCCTCTGC
AGAACGTCATGAAGGCTCTGCGTCAGGAACTGCACGACCTCGAGCTCAAGTACTCTCAGTCGCTCCAGCAGCTCCAGTACAAGCAGCAACAGCAACAGTG
GAGCGAGGCGGGCGGTAATGAAGAGGACACATATTCTGTCGACCTCGTGGAGAGATACATGCAGCTGTCCACCAAGAAGCAGGAGCTGCAGCGAGAGAAC
CAGGAGATGGCGCTCCTGGCAGCGAAACACGAGACTTTCCGCCTCAAGGTGGAGCACTGGGGGGGCTCCGACGGCGCTCCGATGCTGGAGCCGCCTCCGA
TCACGGTAAGACTTCGCTGCTGGGGTTCTGCTTCTGGCAGCCAGGGTGGTCCGCTCGCGAGCGTGGGACCGAGGAGGATGCGCATTAAAGGGAATGGTCT
CCGTTACTGATCTTGGTTTCTTGCTGCTCTCCAGGTTGAGCTGAGCAATATGGTCTTCGAGCCCATGACAGTGTCAGAGTGCCACCACATCGCCATCGCA
GCGTACAGAGAGATTTGTGCCTTCCTGCAGAGCAACAGCTACCTCACTACTGGTGCTGTGTTGTGCGGGTGGCGAGACCGACTGCGCGAGGCGGCAGATC
ATGTCAAGTTCACGCTCAAGAAGCGGTTTATAGGCATCACCCCAATGGAGCTATTGGCTCGTGCCTGGCACGTAGTCTCGTCGCCGCGTGGTCTTGCAGG
GTTGTACTCGACCGATATGCGTCTGTCGCTCAAGGTCCTTCAGATCGTAGACGATCACAACGTGGTCATGTACCGTGTGATTCGGAACGCTCAGACGCAG
AGAGCAGTTCAGTCGGTCTTCCTGGTCTCACGCTTCAAAGTGGCGAGTGGCTACATGGTTCTGTTCCGGTCAGTGGATCGCAATCGGCTGCGGAAGCTGT
GTCAAGGCGGCACTGTTAATCTGGATGACCAGGGAGACTGCGTTGGAGACAACTGGCTGGACATGTTCACGTGGTACGTGTGTAGTGGTTCTCGAAAGAG
ATCATTCTGCAAGGTTGCTAACCGAGTGGTTTGCTGTGTGTCTGCAGGACTCTCTTCGAAGATGAGCCGGGCAACGAGAACGCTGTCGTCTTCAGCTACG
GCGGTATCGTGTACAGCACGGAGGCCGTGAACACTCACACGTGGATGCTGGAGATCTTGCTGCTTGCGATGCGATGGGAGGCTAAGGTCGTGCGGCCTCC
GTTCATGTTGGGTGACTGACAACTGCCCAAGCAATCGTGACTGGAAGTGTACTCGAATGAAATCTAGCTTGCTTGCTTTACGAGGCTTTTACGTGGTAAG
ATGCAGTCTAACATGGTACAAAGGGAACGAGAGGAAACAGGCTCTTAGTTCTTCGCGGCCAGTCGCTCGAACCCACCCAGCACAGCGTCCACGTCGTCGT
GCTCTGCACAGAGTTCCTCAATCTCTGCCGGAGTAAACGCCTGCGAGGAGACCTCGAAGGCCTCGGCTAGCCGTCGGGTCTGCACCTCGTCGAGCTTGGT
GACGCAGAAGTACTCGATCATCTGCTGGACCTGCGCGCAGCCCATGTAGCTCAGCAGGAGCTTCTTGTTCACGCGGCCCGGTCGCACAAGCGCGGGGTCG
AGCTTCTCTGGGTGGTTCGTGGTCATGACCACGATCCGACCCGGGCAGTCGATGACACCGTCCAGCACATTCAGCAGGCCCGAGAGATTCAGCTTGTCGT
TGCGCATGTTGTACTTCTTCTCGTCCTCGAGGCACGCCTTGATCATCGTGGACACTAGCTTGTCGTCTCCAGTCTGCGCGGGTTGTTTGTCGACGTCAAA
TGTATCAATACTGTCGCTTTTGATTGCTGACTCAGTCATATCACCGACACGCGCCTTGACAATGGCCGACGCACAGTCGATGTCCTCCATGACGAAGACG
ACGTCCTCGAAATCCATGTCGATCGGTGAGTCCAGCCCCGCCACCGCAAACTTCATGTCAAAGAGCGCATCGAGCAGCTGCTGGTTGGTCTTGATCTTGC
CGAGCGAGATGGTCACCACGTGGCGCTTCGTGTACTGCGCAATGGCCTTGATGAGACTCGTCTTGCCCGTGCCAGGAGGTCCGTGCAGCAAAAGGCCGAG
CTTGTACGGGAACCCCTTGATGGCGAACTTGCCCGCTCGGTTCTCAAAGTTGTCGAGCAATTGCAGCACCTGCTGTTTCTCCTCGAAGAAGAGGTTGTCG
AAGGTCTTTTCCTCGCCCAGCACGTACCGCTTGTAGGAGACCACAGGCTTGGCGTTCTCGTCGCCGTCCGTGTTGGCAGCCGCCGTCTCGGCCTGGACGT
AAAAGTAGCGGGACTTGTCCTCCACGTGCTTGCGGCGCTCGATGTCCTGGTAGTTCTTGAAGGCTCGGTCGATGATGGCGTCGATGCGCTTGGACGCGTC
GGGCAGCGACGACTCGAAGCGGAAGTTGACAGTCGACTCCTTGACGGTGACTTTCTTGTCCCCTCCAGAGCTCTCGGGCGCGACGGTCTCGTGCTTAAAG
TCCACACCCGGTTCGACCTGGATCCACTCGTTGAGCGGGGGCAGCACCTCGACGTTGAGGCGGTTCACCTCGCCGTAGTACTCGTCGTCGTCGTCCGAGG
ACTCGGAGCCCGTCGTGGAGCAGTTGGAGTCGCTGGTGGCCGAATCCAGCAGCGACTTGGTTGTCCTCCTGTTCTTCTTCTTGGTCTTCTCGAGCAGCTC
GTACTGCGCGTTTTTGGTCTTGAGGTCGAGCACGTCGGCCAGGTAGAGCGAGATGGCCTTCTGCAGCAGGTGATTCTTCTGGTCGTAGTCGTGCACCTTC
CCCCAGCGGTTGAAGCGCTGCTTGACCTCGATTACTCGCGTGACGCGCCGCTCGTCCTTCTCTGGGAAGAGGAAATGCTTGAGCATGGCCAAGAGGGACT
GGGGCGACTGCTGCACGTAGGCCACGACCTTCTGGATGAGCAGCGGCACGAGCATGCACAGCAGCGTGTCCAGCAGCACGTTGTGCGTGCGGAAAGTGTT
GATGAGTCCGAACTCGACGGCCGTGGAGCTCATGGCGGCGGAGGGGGAGCTACGTGTTAGATGCGGTGTGGGCGCTTCGGTGCAAATTCGGAAATGAGCT
GACCGTGTTCGCAGAAAACCAGTCGAGGGAAGTAAGTAAGTATCCATGCGTCTGGTAATGACGTGGTGAACCCACTTCGCTGTTCGCGGGCCAACCAATC
AGCGGCGATTGTTGAAGTTGCCGTGAGTGATGGTGGGTTAAAACCTTCTACAATGAGTAGTATCCATTCATGCAGGTCATCCGGCTCACGAGCATATTCA
TAATAAAGAAGCTTTCAATGTTGTGCAGGATCACACTCTATTGTCAACAATAAACAGGTAAATTGATACACAACATCACGATATGAAGTCTCATCACGCT
ACCATCATTCACATTTTCGATGATCGAGGCGGCCACATGGTGATACAGGCGGCTGAAGGCAACGAAGACAGGTAGGTGCATGTCAGGCCCGCTGGGAAGC
CTTGGTCTCGTTGTCTCATTTTCCAATTCGCCCTCTGAGTGGCATACCTGCACCACCACCAAGCAAGCTACTACCAGGCCCAACCACCGCGCCATGAGCG
ACGCCACTGCGACGCCCCTCAACCCCACGGACGAGTTCCTGCGCAACCTCAGCACGGGCTACGTCGTCCTGGACGCCTTCGTGTGTCTGCTGGTGCCGCT
GATAGTGCAGCAGCTCGTCACGTCCCTCCAGGGCTCGGGCGACTCGCTGCTCAGCCGCCTATACACCCTGCTCTTCAGACAGAAGGAGCCCGAGGGCGTG
TACCGCATCATCGGCATCACGCAGCGCTTCAGCTCCGAGGGTCACAAGATCTGGGACTACGAACAGAAGAACCACTTGCTGCAGAAGGCCATCTCGCTCT
ACCTGGCAGACGTACTGGATCTGACCAACAAGGACGCCAAGTACGACCTGCTAGATCGTCCACAGAAGAAGAAGAAGGCGGCGGCGGACAGCGATGACGA
CGGCGACACGAGCGAGTCTTCATACGAGTCGGAAGACTCGGACGCGGGCTACTGCGGCGCCGTGGACGGTCTGTGCTGGGAGGCGCTTCCCCAGGAGAAC
GAGTGGATCGAGGTGGAGGAAGGCATCCAGTTCAAGCACGAGACCGTCGAGCCCGAGGACACGGAGGAGAAGAAGACCAAGTCGCTCACGGAGACCAACG
TCAACTTCAAGTTCTTCTCGACACTGCCCGATGGCTCCGAACGCATCGACGCGCTCATCCAGCGCGCGTTCAAGAACTACCAGGAGATGGAGCGCACGCG
GTACACGAAGGACACACTCCGCTACTACTACATCCAGACGGGCGGCCCGAGCATTCTGGAGAAAGATGCGAGGGTGACGTACAAGCGGTACGCGCTGGGC
GAGGAGAAGACCTTCGAGAACCTCTTCTTCGAGGAGAAGGAGAACGTGGTGCAGCTGCTCAACAACTTCACTAACAAGTCCGGCAAGTTCGCCATCAAGG
GCTTCCCGTACAAGCTCGGACTTCTGCTACACGGACCGCCCGGCACGGGCAAGACGAGTCTGATCAAGGCTATCGCGCAGCACACGCGACGCCACATCGT
GACAATCTCGCTTGGTAAGATCCACACGAACCAGCAACTGCTGGACGCGCTCTTCGACATGAAGTTCGTGGTGCAAGGGTTGGATTCGCCCGTCGAGATG
GACTTCGACGATGTTGTCTTCGTTATGGAGGACATCGACTGTGCATCTTCGATCGTGAACGCCCGTGACGACGGCGAAAAGCCGAGCAAGGCTGATCGCA
TGTTTGACAGCCAGAAGAAGGCGATGGAGGAGGACCCGGAGGAAGGAGTGGCAGGGCTCATGGGCCCCATGCTCAAACCGAAGGGAGTCGAGGACAAGCT
TAACCTCTCGGGCCTGCTCAATGTGCTGGACGGCGTCATCGACTGCCCGGGTCGCATCGTGATCATGACTACGAACCATCCGGAGAAACTCGACCCGGCA
CTTGTT