Description :
From Genome Similarity Track
Location :
Scaffold_98:79985- 83215
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12483ATP-binding Cassette (ABC) Superfamily

Sequence
3230 bases(100 bases per row)
ACATGGAAGCCGTCGACGCACAGCTGCAGGCGCAAGAAGCCGACGGCCGTGCGCTTCAAGTGCTCGGTCTCCGCAAGGCGTTTGGCAAAGGCAAAGTCGC
GGTCGACGACCTCCATATGGCCATGTACGAAGGGCAGATCACGTGTCTTCTCGGCCACAACGGTGCCGGCAAGACGACGACGATCTCGATGCTCACGGGC
ATGCTGCGCCCGACGTCTGGGTCGGCGTCGTTCCGGCACTTGGACTTGGGTAACGATCTCGCCGCACTCCGCAAGTACCTGGGTGTCTGCCCGCAGCACG
ACATTCTGTACGACGACCTTACCGTCCGTGAGCACCTGTCGTTCTACGCCAGCATCAAGGGGCACTTCGACATGGCGGTCGTCGACGCCATGCTGGACGA
CGTCGGTCTCACAGACAAGGCCCACGTCCAGGCGAGCGCACTCTCGGGCGGCATGAAGCGCAAGCTCTCGGTCGGCATCGCGCTCATCGGCGGGAGTGCG
CTCGTCTTCCTCGATGAGCCGTCGTCGGGTATGGATCCGTACAGTCGCCGGAGCATGTGGGACCTTCTTCTGCGCAACCGAGCGGGGCGTGTCATGATCC
TCACGACGCACTACATGGAAGAAGCCGACGTCCTCGGCGACCGCATCGCCATCATGGCCGACGGCGCGCTCCGGTGCGTCGGCTCGTCGCTGTTTTTGAA
AAACCGGTTCGGTGCTGGCTACACGCTGACGCTTGTCAAGGCCCACGCTGACGTCGACATTTCGGATCTCGAGCATCTTGTGCATGCGTTTGTGCCGTCG
GCGACGCTGCACTCGAACGTCGCGGCTGAAGTCGCGTTCCAGCTGCCAACGGACCATGCGTCGGCGTTTCCCGGTCTCTTCCGCGCCCTCGACACGCAGA
TGGCAGACGTCGGTGTCACCTCGTACGGTGTCTCGGTCACGACGCTCGAAGATGTCTTTATCAACGTCACGACTGCGACAGCAACGACCGGCGATATCGT
CGTGCCGATTCTCGAAGACTCGGGCGTGCCGTCCGATCGCGAGACCGCACCGACCGTGGTGGCGGGCCGCCGGAGCCAAGTCATGGCCCTTCTCAAGAAG
CGCTTTCACGTGGCCAAGCGGGACAAGAAGGCACTGTTCATCGCGGTTCTGCTCCCGGCACTCCTCCTCGCGACTGGGTTTGGGACCATGAAGCTGATCT
ATGCCAGTACGTTGGAAGCTGCCGAGCCGCGCCTTCCGCTATTGACGACCGAGTACCCGGTGCGGGCCGCGCCGTACTACTGTCTCTCAGACGTCAACAG
CGGCTGCACGCGCGTCTTTAGTAGCTTCTCGGGCGCTACGACAAAGCGCGTTTCGACCTTTTCGACGCCGCTTTTTTCGTCGTCGAGCCCCGACGTCTTT
AGTGTGACGTACTCGCCGCCGTCGTTCAATGTCTCGAGCGTCAACGCCACCGTGCTCCGATTCGCGCAGGCGCTGCTCGACGGAACCGCGATGCAAGCGC
AAATGGGTGCGTACATCGTCACCGCCGACACGAACGTGTTTAGTTACAGCATCTTTGCCAACTCGAGTGGCGACCACGCGTCCGCGATCTACAAGGTGCA
GATGGACCAAGCGCTGCTTCGGTCGCTCGCTGGTACCAACGACATTTCGCTTACCGTGGCCTCGTACCCGCTGCCGGCGTCGCGCACCGAGGCGGCGCGA
CGGAAGGCACACAAGGCTCAGTGGGGCCAAACAATCGGGTTCACGGCCAACCTCTTCTTCCTCACTGCTTTTGCTGTCTTTCCGGGCGCCGCCATGACGT
TCCTCGTCAAGGAGAAGCAGCTCACGGCCAAGCACCAGCAGCTCGTGTCCGGCGTCAAGGTGCATTTGTTCTGGGCCGCCAACTATGTCTGGGACCTCGG
TTCGTACCTCGTGCTCTTCGTCTTGGCGCTCGCGATGATCCAGGCGTTTGGTGTCACGGCCTTTCAAAACTCGGCGTCGACCGTCGCCCACGCGTTTACC
GCCGTCGTCGTCATCTTTGGTCTCCTCGGCTTCGCGCTCGTGCCGCTCACGTACCTCGTGTCGTTTCTGCTGCAAGAGCACGCGTCGGCGCAGAACACTG
CGATTCTCTTCCACTTGGCGACCGGTCTCATCCTCTTTATCGTGCACTTGCTCATGAAGACCATGTTGGACACAGACCTCTCGCCGGGCTTTTGTCTCTT
CCCGCTCTTTGCCGCCGGCCACGCCCTCGACAAGATCTCGACCGCCAAGAACGTCACGGCCGTCGCCGCCGACGGCTCGCCGACGCTTGTTCGCGCCGAG
GCCTTTGACAGCGCCGTTGCGGGCAACGACATGCTGTATCTGGCGGCGACTGCAGTCATCTTTACCATCCTCGTCCTCGTTGTCGAGTATGTCTCGACCA
AGTCGCTGCACAAGAAGAACGCGTCGGCGAAAGCAGCCGTGACGACACCGGTGCTCAACGTCGACGTCCAGGCGGAACACGACCGCATCGGTGCACTTGC
GTCCAACAAGGCGTCGATCGACGCCCACGCGGTGGTCACCCACGGCCTCCAAAAGTCTACTCGAACGGATTCCTTGCCGTCCAAGACCTCTCGGTGGGCC
TGCCGAAGGGCGAGTGCTTTGGGTTCCTCGGTATCAACGGCGCCGGCAAGTCGACGACGCTCAAGATGCTCATGGGCCAAGTCGCACCGTCGGCCGGCGC
CGCGTACCTCGCTGGCTACGACGTCTACAGCCAGCAAACCGAGTCGCGCAGCCTCGTCGGCTACTGCCCGCAGTTCGATGCGCTCTTTGACACGATGACG
GTCCGCGAACACTTGGAGCTCTACGCGGCGCTTCGGGGTCTTGACGTCGCCAGTGCATCGACCGCCGTCACGTCGCTTTTGCACAAGCTGCATCTGCAGC
CGTTTGAGCACGTGCTTGCGGGCGACCTCAGCGGCGGCAACAAGCGCAAGACGTCGGTCGCGATCGCGATGATCGGGTCGCCGCCCATCATCATCCTCGA
CGAGCCGTCGACGGGCATGGACCCGGTCTCGCGCCGCTTCATGTGGGAGCTCATCTCGGACATTTCGACGACGCAGCGCGAGTCGACGGTGATTCTGACG
ACCCATTCGATGGAGGAGTGCGAAGCCTTGTGCTCGCGCGTCGGCATCATGGTCAGCGGCCAGCTCGAGTGCCTCGGAAGCATCCAGCACCTCAAGCACC
GGTTCGGGAACGGCCTCGTTCTCGACATCA