Description :
From Genome Similarity Track
Location :
Scaffold_21:79984- 93974
Transcript NameFunction/comments
Phyke_g1371U4/U6 small nuclear ribonucleoprotein Prp31
Phyke_g1372hypothetical protein
Phyke_g1373hypothetical protein PHYSODRAFT_426731
Phyke_g1374hypothetical protein

Sequence
13990 bases(100 bases per row)
TGTCGACAGTCAGCCGCATCAGGACGACACGGAAGGTCTTGTGGGTGCGCGCTTCCGTACTGAGCTCGTAGGTaagatggagaagtggcAAGAGCCACAG
AAGGCGAAGACTAAGAAGGCACTGCCTATCCCCGACGAGAAGCCGCGGCGCAAACGTGGCGGTAAGCGTTATCGTAAGATGAAGGAGCGTATGGAGATGA
CAGATGTGCGGCGTGAAATCAACCGACAATCCTTTGCGACTGCCGACGAGGAATACGGTGATAACGCAATGGGCATTACTTCCGGGCGgcttggccaaga
aggatCAGGCAAACTTCGTATTATGCGgaaggagcagaagcaatcAAGCAAGAAACTGCGGGCTGCGAACTTCGCTGCTAACGGTAAACCACCACTTTCC
GGTTTGGCTTCCAGCCTAGCATTTACACCTGTGCAAGGTATCGAGCTCATGAACCCCGAAGCCGCGAAGGCTCGCGTTGCTGAGGCCAACAAAAAGTATT
TTTCGGCGGCTAGCGGCTTCGTTAGCGTCGTCAAGAAGCCATGATTCTGGCCAAGCAATATGATTGGCAAGAAGATGTGGGTGGGGGTTGCAAGTGCTGG
GAGTGCTGGGAACAGTGGGGCGAGTAATATTGCGAGTGAAAGAGTTAAGCGAGACGAACGGCTAAACAATGAACATCATGTCTTACTGATCCAAGTTTCC
TTATTTTACTTGGTTCGTATTCTGATGGAGTGACGTCATCATGGAGGCTACACCGTGACCGTGTCCGTCAATTCGGCCCCGTGAATCTCAAATGTCATGA
TCGGTACCGTGGGAAAGTCAGCACTGAACCTTGTGCTCTGACCAATGAAAATGTTGTAACTTGAGATGTTGTATTGCACACCAGTGTCAATAGTATTTGG
GATTGGCCGTACCGATCCAGTTATCTCCGGGGTTAGATTGCATGATCCCCACCACCCCACTGCCGGCACACAAAAGCTGCGAGTTTCATTTCGTTGATGT
CCCTGACGATGTTCTCGGCCATAGTTAGCCCTGTGgtatcttcatcagcatATTGGAAATCCCAGGTCGgcctcttcttgctcgtaAGTACTTCGAACTT
GTCGCGCTCCATGCCGGTGTACGGGGTCAGACTATCAGAACCATGCGCATTGAACTTTCCGATGCTATCAACACCGGGGAGCACGTCTGCTATCACCGTT
GTGAGCGTGAATAGCGACTCCCCCGGATTCTTTTGCTCAGCACCTGAAATCAGCACATCTTGCAGACCGAGCAtgtcgagctgcttgcgtAAGAGCGTCA
ACATGTCGCTTTGCGTCGCAATCGAGAAATGGCAAGCCTCCTGTGGTTCTGGAAATTTCCAAGCCTTGCTATTAGCCTCATTGAACAGCGACGCGTAAGC
GAAGTTGATACCCCAgttctccttggcctcgttCACGACCGTGGCCAAGTACAGAGCGAAGTGCTTTTTGTACGAAGCCTACAAGTTGTCTGCCTCACCA
TCGTtcccagcagcagtagcaagaTTATTGGTCATCCACCACGGAGGAGAATTCGAATATTCCTCTAGCACATTCGCACCGCGATCCGATGCCAATTTAA
GCATAGCCCGTTGTTTGGCGTCAGCAGACCAGTTCCAGCTTGTCGATGTCGGATCTTTGTTGATCCAGTCCAGCCGGAATGCCTCGATTGCCTTGAACGT
AGGCAGGATGCATCTTCAACGATAACGTCGGATCCACGTTAAGCTTACATGTATTCTCATTGTGAGCTGTGAGCAGTAGATTTTCTTTTACCTGAAATCT
TACGATCGGCCTCATTTGACCGGCTTGATTAGATCGGCTAAGGTTCACTCACGTTACAACACTGTATGGTTCTCTGGCTTTCATCAAGCCTTGACTCGAT
GTCCATGTACATAGACGGTAATCTGTTGTACTCTAGAATACGAATGTGCTTTAGCTCAGGCGTCGTTGCCTACTGTACCCGATTAAGTCAGTCTAGTCCG
CACTTAAAGGAAGTACTCCTCATATTTTTGCTCGTAGATGATGCAGAACCGCCGGTCTGGGGTTCGACGAACACGGTGCAGCGTGCCAGGAATACGTCCT
TCCGTGGCGCGCGCCAGCGCCTTGCCGCAGAACAACACAATCTCCTTGCCAGGGACACACACCTTCTCAGCCTTCAGCCATTGCTTGGAGTGAGGGTCGT
ACACATCCAGTCCCTCCACGCTGGGAACAGGTTCCACAACATAGAGACTTGGGTCCACGTGCTCGAACACATTCTCAGTCTCAGACTGTCCGCTGCCCTG
AATATTTGGGTAGTGCAATCCATAGCAAACTGAGAAATTCTCATCCGAGCGCGCGTGACTCGGCGCAATCTCATACCCCACAGTTAGACTCAGCGCACGA
TCGCAGATTTTCTCCATGCGGCGCTGCAGTGACAACCAGTGATCCTTGAACTCTGGTGACGGCCAAACCAGACGTGACATATCGCCACAAGCAACCCGGA
AGCAGTCGCGAACACTTGTGTGTTCGTATCCACAGTACCACATTGGGGTCTTGTTCTCATTGCGGTAGATCTGCTTGCTGATGCATTCGTTCTTCCagtc
gtcatcgtcactcgTGAAAAATGTGTCAAAGTCCTGTAGCACTTGGTCGTGAACACGTTCCAGAGACTCCCCAAGGTCTGTTAGTACTACGAACGAGTGA
CactccatcatctccaagaACCGGGAGCGATTCTTCCAGTTAAGTTCACTGAGCTTCAGACGCGGCACTTGCACTGCATTACCAGTAACTTGTACTTCCG
AAGCCTTTTCGGTGGTTTTGCTGGGTTTCTGGGCCTTAGGGTGGGTAGGATTTGTAGCGGTGGTTTCGGGAACTTCGCCGGTTGCATTCAGACAATAGTA
ACTTGCTCGTAGAGAGTAGTTGGTCGACATGAGGGGCTCTGCTAGGGTCGTCGTCGTACTCGTCgtcatggtggtggtggggccAATGCACGAATGGTTT
GGACGTTTTTTTACGGCATTAATAGAGGCCCCACGCTTATTTGACCAATCATAAGTCGTTATATACATTATAGACCAATCGATATGCAGGAGACCTGGTT
CAACAAGTATCAACTGCTTTTCCTGTTTGTTCAGCGATGACTTGCTCGGTGTTGGTTGATGTACAAATATGACAATTTTATATGCTAATTTATGGCAGTG
CTCGCGATGTTCGGCACACAGATCTACAGAATATAGAGGGTGTAGTAGGATCAGACACGAGCGCGACTAGCGGCAGAGCTGGGGCGGCTTCGAACTGTGG
TGGGCTTTGGCCTGGTTGAACCCGGCTGCTCCTTCGCGGCTGATGACCACCTTGGGTCGCTCTGGAAGTCGAACAGACGCGACCGCACCTGGTCCAGACG
GCCTTGTCGTTCTGGAGTTTGCGGTCTCCGTGTTGTCCTGCTGTTGAGctgcttggccttgtcaGCTGCCATGTTGCGATTGCGCTCCTCCAGCTGACGC
CGACGCTCAAGGTTCCTGGCCTTCGTAACCGCAAAGCGCGACGACTGATCATAGTCCATATACCTGGAAACTGGCGCCGAATCCGACCAATGCGTGCGTG
GGGATGCGGTCATCATTGGCGGCGAACCGTGCGTCGATACGGAGAAACGTCGCGCGGACTTGCTAGTCGGTGGCGTGCTCGTTGTTGAAAGTGAGGAACG
GCGAGGTCTGGGGATCACTGACGGCGCTGGAGCGGCGGCCTTGGTGTACAGCGACGAGCGACGTAGGTTGGTGGCCGCTGGAACTACCCCCTTGGAAGTT
GTGGATGGTGATCTACTTGAGAGGGAGGATCGTCGATATAACGCAGGATGGGTTAACTTGGGTGCCACAAGGGGCTTAGTTCTCTTGATGTTTTCGCTTG
ACGCTTGCAGTAGTTCAGGCAGGAACATATCTAGGGAACTCAACAAAGAGTCCAAAGATCCGGTAGAGGCTGTGGAAAACGACGACGGACTGCGAGGCAT
AGCCGAGTAGCAATTCACGTAGCACATCGTCGACCCCACATAGCTCTCATCTTCGTAAGGGTTCAAAGTTTTGATgttgtcctcgtcgtcactctcCAGA
GTCTTGACTGTGAGTGTATTGTGCTTCACAACAGACTCAGGGGTCTTCTCCAATTTCTGAACAGGTTCCGATTGGGTACGAGCTCGACTAATCTGGTTAT
CTACCGGTTTCTGAGGCGCCGTGGTGCTTGACTCCGCCCTCGTGCGTGAGGCATTGGACGCTGCATTGGCCTGCGCCATGAGCTCGAACTTGTTGATTAG
TGACTGTACGTTGGCAGACtcgctgaagcagcagtcgtcgatCATTTTCGATGCAGTATAGTAATAGTCAAAAGGCTAAACAGTTAATTGGTTTTGGTGT
GAGCTCTCCGAGTGCAAAGCAGAACTGACACTGGGCGGAACGATGGCGAGCGAGCTCGACACTGAGGCAGGTAGGCAGCACGTTACAGTTTCTAGAATGT
TGTTTGCTGGCTCTTGCAGGCAGGTCCTCTGGCCCCCGCCGGCACCTTGCGCAGGTCGCAAAACGGCAGCTCGGCAGTCGCATGGCAACTTCTGAACTGA
TGGGCACGAAACGGCTGCACCGTTTCGATTTTCCACGAATGAAAGGGCAGGAATAATGATTTGAACCAATAAAAGATCGCGACATTTAAACTGGATGGCG
CGAAAACCAGATCGGGGGTCTGCTAGATACAGAGGACAAGGATGGCAGGCTCGCCGACGGTTCCCAGCAGCGTAGATGGTATAAAATGGAGGCTGCAATG
AGCTGATCATGGGGGAATTGCGGGAAAGGAAGATCTTGTGAAGATGGCATGGCCACGCTGTGGGTCAAAGAGCCGTCGGCTTGGATAAATGTTCTGGACA
CATCTCAACTTGAAACTCAAGGGGTCAGTGAACCACTTGACACTGGCAGTGATGAACATCATATGCCGTGTGTAGAAATTCGATGTGTTCGTCGAGCGGC
GGCCACTCGATCTCTATGCGATACGCCTGATTCCTATTTGAAGTGCACTGCAACGTGCTCCAGGACAGGCTCAAGCGCCAAGCGGCACGGCAAAATGGCT
GGATTGTCACATATATCGCGATCTTGAAACAATCCTTGAAGCGATCTTCAGGAGACAAAGTACGTCAGTCAAGACATGTTGCCTACAGTAAGGATGTATC
CATTCCTCACGGTTTCCTCCGACCCGACTTAATAGGCATAGCGCAGTTGCACCGAACCCGGTGCAGCAGACTTTGCGAGCTCTTCAACCAGACCTTCGTT
GCAATGCAACTTGTATTCCTTCCTACATTGCAATATGCCGGCTACGTGTTGGACCTTACATCCATACGTGGCGACTGGTTCTTGCGGTGTTCTCTCTCCT
TGCGGATTTGCTCCTGTACGAAACTGCCAAAGGATTCTGCTAGATCATCGATGCGCTTCTCATGTTCGTGCTTTTGCGCCGACAGTTCTCGCTCTAGCTG
CAACACTTGATtctccatggacgagatcacAGTTGCCTTCTCCTTCAAGCTCGCGGCGCTCTCCTCAGCTGCAGTCTTCGCGGAAGAAGTCAAGTCCTGC
AGGCGTTCGTCAAAGGTTGTTTGCATCTGCACGAATCGAGcatcctgctcctccattCGTCgtagctggagctggagcttctcTCCACAACGCGATTTCT
cgctcgttgctgttgccaacTGAgtctgcttctcctgcaaaGCCTTGGACTGCGCCTCCAATTCGAGCTGGAGCTCATTTTGTTTACCGTCGCTCGCTTG
CTGGAGCGAAATGTTATCCTGACGTAGCTGGATGATAGTCTGCAAGTGTTTTTCGACCTCACGCTCGAGATGTTGTCGTGACTTCTTTACTTCTGCCACC
TGCGCCTCAACCGATCCAACCGAACGCTGTATGCGCTCTTGCACTTCAGCAtcccactgctgcttcagctctCCGATCATCTTCTCGTGGTCAATTTGAG
ACTGTAGAACCTTCGCTTGTAAGGCTTCGCACTTTTCCTTCAGTTCACGCACACTTCGCTCGCTCGATTCTAGTTGTGTGGAGGTGTAGCTGAGTTGGGT
TTGAACAGACCCAATGACCATATCGTGTTGTCGTTGCGCGGCACTTAAGCTGCTTTCGTGGTCGGAAACCAGCTTGGCTTCCTTGCGGGCATACTCCTGT
TGTAAATCTTGCAACAGCTTTTTCAGTTTTccaatctcttcttcttgagtcCTGAACAACACTCGAGGCAGATCAAGACAACGTCGGTGAGGCAGCCGAC
ACTTACAAGGCTCGCAAAATGTGGTTGTTCGCCTACCTTGCGGTGAGAGTGGTGCGATGTATTTCGTTGTCAAGCGTATACTTAGCATCTTCCAGCTGTG
AGATCTGCTTTTCCTTCTGATCCACTTCTTTACTGTGCAAACTCTCTAAGTGAGCCATCTTTTCTCGCATCACGTTATTTTCACGCTCAAGAGCTGTGCG
TGACGATCGATATTCCTCAAATTCCAGCTTTTTGCGATTCTCAAGCTCATCGAGTTGCATGCGCAGTTCGTGAAGATCACGCTTTGCATCAATCTCGCGT
TGCTGGTATCGACCTCGTTCTTCCTTGGCCATCTCGGCGTCCTTGCGGGCCTGTTGGAACTgtgcctccagctcttcgGTCTTTTCAACCTGTCATTTAA
AGTGTACATATGAGCTACCACCAGATCACTGCAGAATTTATCCACGACGCAGCCTACCAATTTCTGTCGATCTCGTTTGCCTATGTTTATCTCCGTCTCg
agctcttccttctctgctAGCACTTGCAGCAATAGCTGGTCATCTGCCGGTGACTTCACAGCGTCATTGTTCGATTCACCGCCTTCGTCAGGTTGGCAGG
ATGCATCGACGGCCAGAGGTGGCTGCTTCCCTATAAACGCGCGGTTTCTTGAAAGCAACATCTCGATCTCATCGACgtgcttcaagctgcaatTGTTGCC
CATTAACTCCAACGACACCAGCGAATGGTTGGTTTGCAGCGCCTCACGGAACGCTAATACACCTGGATTCCCGACCTCATTCCATCGTAAATCTAACTGA
CGCAGCGTGCGGTTGCGACGTAAAGCCTTGGCAAGTGCTTTGGCACCTTCTGGACCAATGTTGTTGTTACGCAAGTCGAGCGTGACTAACCGAGTGTCAA
CTTCTAACGCGTCGGCCAGAGCGTCCACACCTTGATCTAGCAAACCAACATTGTTCCACTCCAAACTAATAGACACGATATTATGGGAAGAGcgcagcaa
tgctgccagtGCCCGAGCAGCGCCAGCTTCGAAGCAGTTGCCACGCAAGTCGAGTCTTGTGGAAACACTCGTAAGTCGCgccttctccacaatctccGCG
AACTTGTCGTCCCCTAGATACGAATTGCTGAAGTCCAATACTGCATCGGAAGATTTGGATGAAGGAGATAATGGTGTCGGGtgcacaagtgcagcagtCT
CTCGCTTCGCTTGGATCGTCATTTTCGTTACGCCTTTTCACGCACAAAAGATTTgagcgcttcaacttgaacgCGAATCAACGACAGCTCTGACCATGTG
GTAGGTATGAATACGGATCCACCAGGGTGGTCGATTGGGGTTTGCACCCAGCAGATGAGCAGAATTCAACACAGAACTTATACGTTGGTCATCACGATTG
CTATTATACACATTGAAGGGCTCTGGTTCCTCGATCGCAGCGCATCATTCGTTTGGTGCCACAGTTCCCGGTCGGTCTCTGAAAACTATGGGATAGTTCA
TGGCTCACTTTTGTGGTGCGCCACACCTCCTTTGTATCTCGCTGGGATGTCCGTGAAATATGGCTGCCGTTATTGGATTCATCCTGCGATGAGGTCGCCA
TGCTGGTCGTTGCTTCGGTTTGAAATCCGCACGCCAGTACCATTCGTGTGGATGAAGGCAAGATGTCGAACACAAGAATAGCGAAATGAGATGTCGCGCC
ACCTGGCAGCTCTGACGTGCTGCCACCGATTTGgcaggaagctgcagtttcgTATGGTGGCTTTATTAATACGGAGGCTGTGCACGAGTTTGGAAGAGAG
CGCCGTGCAGCTGGGATGGTATCTCAGTCAGACCTTTGCCATGCATAGATTTCCCAAAGCATTGTTAACTGCCGGCGGTGAGCcagctgcagaaggcatT
GCTATGCCGAGCGTTACCAATAATCCACTTGTATATATAGAGGCCTCGCTGAATTTTCGAGTCGACTAATGTCTAGCTCATTTATTCAAGCACTCTGTAG
GTGGTAAACGCTGCGTTAGTCCTGGTTTGCAATGGCTCCTATCACCGACCTAGCGATGACACTGCGGTCGCGGATACAGGGGCGTATTGGTAGCCTTCAG
TGTGTGGATTTGGTGGAATGCCCAACCTCACAAAGGCTATTTATCGACAAGCACACGCTCATGACTTCCACTACCCCGGAAGGTCGAGCCGCGAGCGCTC
TCGCCTTGCATGAGCTGGACCTTCACCTTTCGGTTCGTGATGTCGAGAGCATTGTCAAACTGGAACGACATTTGCTACAAGGAGAGCGACTCCACCTTCT
ACACGAGTACTGCGCTCACGGTGATTTACTCGAGGTcatgcagcaagagcttcgaCTCCAATCTGCAGGCTTGTCGCCTCAAAAAGCTGCCGTGACGACT
TGCACAGATGCCGGTAGACGTCGGATTTTCTCTGCTGTGCTGCGGGGCGTGCAGGCATTGCATGCCATTGGGATCGCTCATTTGGACCTGTCGCCCGAAA
ACGTATTCGTGGCCGATTCTGGGGTCGTGAAAGTTGGAGATTTAGGGCACGCTCAACGATTCAAGCATGGTCAACCAATCGTTCGTGTCGAACAAGTCGC
TAAAGAAGCTTACGCAGCGCCGGAGTTGCTACTCACTAGAGAAGTTGACGATATCCGAAAAGCCGACGCTTGGTCGCTAGGGGTCATCCTCTGGACGCTG
TGCACCAAGCGAGCGTTCGTACGTCGCGCCTCAAATGATGACGCACTCTTTGAGCGGATGGTTGAATTTGGCACGGCTACTGCTCTCCAGGAGACTGGAC
TGCTGTCGCAAATGCCATCGTCGCTGGCTGATCTGATTGTTGGTCTATTGGAAATCGACCCGGGGGCAAGACTCTCAGTGGACGCTGCACTGCAGCACCC
ATGGACGAAGCTCTCTGCTTCCGACACGGAGACGGCCAAGCAACCACAGCTATCTCGACGAAAATCTATCAGCAGcatgatcaagaagaagggcgaagac
ttgatgaagaagcgCCCCAGTGTTAAAAAGGGGCGAGGCCGTACGGCTAGCGCAGAAATTGCGCTGGAGGCAACGCGAGTTACACTAACATCACGAAGTC
GAGCGTAGAAGGAGTCAACACGTATGAGCCGCAGTAGCGTCACCACAACTATAAACACCCGAAAAATATGAAACCACCTCGCCTTTGCTCAAATGAATTT
GTCCCTTCCAAGCCGTCGCGACGTTTGCTCGAGGCCATTGTGATTCCTCATCTTTAaatcgtcgacgtcgtctaGCAGGGCCGGTTGTGCGTGCCGACCG
GTACCAATGCGCCGACACTATCTCTTCGCCGAGGATGAAAAGGAGCGCAGTGTTGGCAACGGCAAGGCCAACCTGCTAAAATTGTGGCATACTCGACGAT
TGGCTATGATTGAGGGCGACGAGTCTGCGAACGGAGGCGAGGCAAACGCGTTGGTGGTTCGGGAACTGACGCTGATGTGGGACCTCGCCAAGCCTATGAC
GTCAATTCTGCTGTCGCGCGAAGGGTACATTGGTTTCTTCGCTCGTGCTGCAAAAGCTCTTGTGCTACCAATGACATCCGATACGgctgctattgctgtt
gcacaGCGCGACTGGGAGTACGATCTAGAAGGTGTCAGTAGCATCAATGAGCCCACCACCAAAGGAATGTCAGTCCTGGACAACGAGATGATGGCACCTG
AGCAATTCCGTGAAGCTCTGATGCAACTCGCTGAATTGGTTCTTCCGGTAGAAAGCACCGCTAAAATATTCGCATCTTTCTTTCGTGAGCTGCGTAATAG
CGTCGCGGAGGTTGACGCCATTTCCAGCAATGAGCCGGAGACCAACGTCGGAGATCCGGCCGATCGCCTTGTGCTCCGACCATTGAGTCGTATTCCTAAG
ATCAGCAAAGACGCGTTCCTGCAGAAGTTGCCACCATCTAGCGATGCATTGCGAGCAATTCACGGATTGCAACCGCCCGATTCCCGCGAGATGTcactga
agcagctcttACTCAGCTATAATCCACGAAAATTCTCTCTCACACGAGCATTTCCGCACAAAGATCAGTCTAACGATAGTATCGATGAGAGTGTGAGCAA
CATCGAGGAGATTAAAACCGAAGCTACAGATGACCCCGAGCCCATTGTCGAAGATGATATGGTGATGGCACAGCGACTGCATACTGAGCTGCTTGGTGCG
ATTGGTGTAGGGGCGACCCCAATTCGAGGACGTAGACTTCATCGCGAAACCACTGCACAATGGGATGTGGAACAAGCACTCGTAGATACTCTGACGGAAT
GTCCGGCGTTGAGAGTAGCAGTAGTGGGGCCACCTGGATGCGGTAAGACTCGACTTGCCCATATACTAGCACGACGGCTTGGGCTACGATATCTGTCACT
TGATGGGGCTGTTCAGCGTGCCGTCGAGCGTAAAACCCGCTTGCGTCGCCTTCGCGTCGTTGCTATCCCGTCTACCGACGGCGAAGACACAACAGATGAA
ACTCCGCCATCGGTGGAGATTTCAGACAACGATGAAAAAAATCCAGGTGAAAACActgatgaggacgaagacatGGACCGGATATTTCAGGATGAACATC
TTGACGCACTGCTCTCGGGGTGCGTGGTTCCCCGTGATACAGCACTTGCAGTACTTCGGTTAGAAGCTACTCGTTCGCTGCTTGGTACGTTTGCAAACTA
TTTCCCTCTAAAAGATAGCTAACTCATGTCTTGCATCCAACACCAACTATTATCGTGATAGCTGGCGTTGGAGTGATCATGGACAACGTGTATCCGTCTG
ATCTTTCAGCTATTGACAACCCGGATCATAGAATAGGAACCGATTACTTGGTCGCTCTCACGGCACTGCCCAGCGAGTTGGAGTATCAGCTTGGAGGTTC
AGAATTGGCACCAGCGGTAGGTCGTTTGTACTCTGTTCGGGAGCTCGCCACTTTGAAAGCGGCAAGCCACGAAGAACTAGCCGCAAAAGGTTTCGCTGAT
TTTCTCTTACCAGAGAAGAAACTTGAGGCTGAAGCTGAGGAAGTTCAGGGGCCTTCTATTGCAAATGGGAATAATGGAACTGAACCTGGCACCGAAGTTC
AAGAAACCAGCGAACACGACTCAAACGATCAGGAGGAAAATGAAGGCCGGGATGACGCTCCACCGGAAGAAATTATTGTTCCAGCACCGGAGCCAACACC
TGCCGAGCGCAACGAAATCGAATCGCCTAGGGAACCTACTGTCTCGTTTGGTACAATAGTTTTGACAAAGTTTGCCCAGAGATACCACGAATACGTCACA
CGCATGCAGCGTGAACTCGCGGTGTCCCGAACTATTGCCAGCACGGACAGCTATCATTTGGTAGTGGTTCAGGCCACCCAGTCGCTCAGTGCCATTCGAG
ACCACTGCATCCAAGTGATCACAGGCGTAAGTAGAATCGTAAATTGCTTCACGGGCATTTTCACTTATTTAACGCTCGTGTATTTTTCAGACGTCACTGG
GTCTGTTGCGCTTTAGCGTATCACGTGAGGCCTGCCCCGTACTGCTGCCCGATGATCTTAGTAATACTAGTCGTGCTGAAAATATGAGGTGGTTGCTTTA
TGGAGACTGGACCACGCTTctcgaagctgaagaaaGTTCCACCACAAATATGTCGTTCACCCGGCTGCCTAAGCGCAATGCAAAACGCCGATTGCTATCC
AAGTGGCGCGAGTTTTGTCCCGTGGCATCATCTGCGAACAATGAACTAACACTCGGTAGTCCAGAGTTTGCTGTATGCTACTCTGGGCGGGTCTACCTGC
TAGCCTCACGAGAAGCGAGGAGCGTCTTCTGCGCACATCCCCTGCAGTTCTTGCGTCGAGACGTCCCAGTTCCGTCAAAGTTTCGCAATTATTGGCTTGT
CACCACAGGTGGTGGCGATATTTTGTCTCCTGCGCACTTGGAGACACTGGAGGCAGGACTTCGCGTGCGAACTGTATCAGCCTCAAGGCTCCTCAAAACT
TTACCAATATCCATGGAAATGCGTCTCATGAGAGGCCAGGTTGTTTCCCCTGTCGACGTTGCAACAGTAGCAGCCGAGGCATTAAAGGCACAACTGGCCA
AGCTGGATGCGTCCTCTGGATGGATGCTCACGGATCTGCCGCTCACGCGCGACGTCGCTGCCGTGCTCCTCGAACATGGATGTGTACCTGACGCAATTTT
GttgatggacgaggagcttACCGCTGCTAAAGAGGAGGCGGAAGTCATTAGCCCCTTGGCTGCATTACGGCGTCAGCAGTTCCAGACAGAGAAAGCTGGC
ATCGAGGATGTTTCCCAAGCTCTCGGTGGCACAACTCGAATCATAAATTGTCCATTATTTCATCAACCGACCGAGACGCTGGCGGCCATTGAGCGCGAGC
TTAATCCTCTCGCACCGCGTCTGGACAATATTGAGGACGGACATGCGCCACAGATGGTCGACGAATATTACCCAGCGGCGATATTTGCCTCACCACATCC
AGGCAACtatgaggaggacgaaggaAAGTTTGTGTCTTTATCACAACAGGATGAAGGCGACGCTCCTGATCCTGaggcagttgcagcagctgaagccGCA
AGAAAGACATCGCTTCAGCTCCAGGGTGAGACTGGGCGATTCTGTCCGGTAGCGTGGCGTACGCGCGGCGCGATAATACCTGGACAGCCATCATACGTTT
GTTCGTTCCGACAAAAGTTTTATGCCTTCGCAGGAGAACAGGAGCAACGCGCTTTTGAGCGAAATCCAGCAGCTTACATCCCATCGGGACCACGTGCTAC
TGCTAGTTTTGTACCATGTGTACTGCTACTTGGTGTGCGGGGATCCGGGCGGAGGAGAATTGCGGATGCACTTGCACCGACCCAAACGGAACTCGGTCAT
GCACCAATGGAGTACGTGAATTTAGACTTGACTGCCGTAGCAAGTGATGCTGACCGCCGCCAACAGCTAGAAGAACTCAAATCCGAAGATGCGCGCATGA
AACCCGAAGAATTATTTGTCAGTGCGCTTCAAGCCGAACTGAAGCGGCAGCAACCTGTTCCTGGGGAGGCTGTTGCACATGTCATTGCTGGGCTTGGCCA
GGATCCTTCACGTATCCCAAGTGCAGCGACACTGGAGATGTGCTTTAAGTATGAATTCTTCCCGGTACTTGTAGTTCCCCTGGTCATctcggaagatgaa
gcagtggCTACTCTGCTCAGCCGATGGACTGACAATTTACCGGTCCCCCGTCGAAAGCTTGCCCTCACTCGAAAAAAGGAgaaagatggagaagctggtg
atgacggcgatgcactggaagaagacgacgaggaggaagaacctCCCGTAGATTTGGAAGCGGCGCGAGAAGATGAAAGTACGCGACTGCATGAACAATT
CGTCGAGGAtcagaagatgctggatgaagccatCGTTAGCCTCCGGTCTCGTGGCGTCAGGGTATGTAGTCCGGTCAATGCGTCAAGCGCACCAAGACAA
ACATCCAAACGTATAAGTCGTATCTTGAACGAATTTATGACAGGACGAGAAACGCTTTTTGAGCGCTGCGACGTACTAGATATGACAGCGGGAAGCACAA
TGCACCAATTACTTTCGTCAGGGGAGCTGCTAGTCGGTAAGCATGGATTTGTGTGCCCCGTGACAGGACGTACAGATTCTCTCTCAGCCA