Description :
From Genome Similarity Track
Location :
contig_10:799688- 801127
Sequence
1439 bases(100 bases per row)
GATGCTTTCGGACCTCTGGGAATACCGGTGCTGTTCATTAGCGTGGTGTGTCTGGCGTGGTCGTCATGGCTCATTTTCATAGCGTTAGCACCAAACGAGG
CGGCGAATTGGCTTATGAATACTGGTGCGTATGACAACGGGAGATTTTGGTATATCAGTGATCCAAACCCTACCATCACACTGGCCGGGGTCGTAGGCCT
CGTCGTTGTCGCGCTATGTTACCTCTTGGTCATTTTAAGGATGATATTCCGGCGAGAAAAGTTGCTTTTTTCGAGTTCGCGGAATAGCACAGTCCGCTGG
TCTTCTACCACGCTACTAAAAATCATTGGTCCAAGTTACAAACGCGGATGGGACCTCTGGAACGAGGTCACATCCTACGAGGGGAAGAATCGCAAACGTT
GGGTACGGCAGAATACCAATCTTGATATTCTGGACGTTACGTGACGAAAGCTTAACGCTCGCTGCTTTTCTAGAATGCTTTTCTCAAGCTTGTCGACTTG
GCAATGGAAACAGCCATGCTTCGACAGCTGCTGCAGAGTGGCAGTCCCACCAGTCTTACCTATGGCTATGCGGCATTTCTAGCAGTGAATTCGCTCTCCT
GCATCGTCAATGTGCTAGCAGATCGCTTTTCAGCTTTGACGGAGATTATTATCGACTCAATGTACGTCAAACATGCGTTGTATTCATCCTGTATTGATTT
CTAATGCATATATGTTTTCAACTTTAGCTTCGACTTATCCGCCGCTGTTCTGTTTCCGATTCTGACACTTGTGTACAGCTACTACAACTTCGACTTTGAT
CGCGAGGTGTATCTTACTTATCTCGAGAACTTCCTGCTGGAAGCTTTGAGCATAATGCCCGATCATTTGCCGATCCATCTGAGATCGCGCTGTTTCAGGT
CAACTTTGACTCACTTCGCATTCGCTCGTTACTGGATTTTACGCTGCGCATTAGTATGAACCTGGCACTGTGCTTCAGATTTGAACGAGTTTTGGAGGCT
CTTGTCTGGACGAGATACCGCGAATACGCGTCCCGAGGGGTTAAGAAAATCGTACTAAACAGTGCAGCTCCAATTTCCCAGAATCCAGTCCCGAAGACCG
TGACGGCCGTATTTCTCGCTGTTATCCTAGTCATCTTAATGTCGACACACAAAGCTATCGCCGATTCTGCGGCATTATGCGCTACGTATCACGAGTGCGT
TGTGTACGCTCATCGATGGGAAACAAGCGATAAATATTGTCCGTGCCTCATACTTATTAACGTTGATCTCACGCCGAAGACTTACGACGAGTGGTTTAAC
GCCCAAGATGCGACGAACAATGTAAAAGCATTGGCAGGTGCTGGTTTGCTGACGTCGCTTCAAGTGATCAATCGGCAACTGGTTGAGTTGCCAGAGGAGA
TTCGCAAGTGTAGCGGACTCAAGACAATGTGCGTTTGCT