Description :
From Genome Similarity Track
Location :
Scaffold_3:79968- 81969
Transcript NameFunction/comments
Physo_558663Hypothetical protein
Physo_496322protein kinase, putative

Sequence
2001 bases(100 bases per row)
GGCCATCTTGTCAAGGACGTGTATTGCGAAGGCGTGCACCCAATTGTTTCGCGAAGTGACTCAAGCGAGGTGGATGAAGCTATGGATGATGAAAGTACTG
CACCAGTCGTCGATGTGGTGTTCGTGCACGGTCTACGCGGTCATCCATTCGGCACATGGCGCACTCATATGGGCAACAAGCTAGAAGGTAGCAACGACAT
TTGGCCGGACGTGTTACTTGCGGAAGATTTGCGGCGCAACGGCGTACCTGCGCGTTTGGTGACGTTGGGCTACGAGGCTGGCATGGTGAGTTGGTCGAGT
CCGTGGCCCTCGCTCACTTTGCAGGAGCGTGCGCGTGTCATGGTGTCGGCTCTGTACGCTGCAAATGTTGGTCGCGACCGACGCCATTCGGACGGACCTG
CTCGTCCCGTTGTGTTCATCACCCACTCTATGGGCGGACTGCTAACCAAGAAGATGCTGCTAGTCGAGCGTGAGCAACGCGATCGATCTGGCCTTGCAGA
CAGCACGAAAGGAGTCGTGTTTCTCGCTGTGCCTCACTTTGGCTCCGATCTAGCCAAGGGCGTGCGCTCGGAGTCCATTAGGAAGCTGATCCAGACACAC
CCGGCCATCGAAGACCTTGGTGCGGACCCGAACGGCCGTCTTAAGGACCTCAACGAGAGCTTCAAAGACTTGGGTATCGACTGCCTCAGCGTAGGCGAGG
AGCGCGCTGCTCCAGTGGCGCTTGGGCTCTCCGCTGTCGTCGTGAAGCCCGAGTCGGCCGACCCAGGCGTCGGTCGCTTCTACGTGCTCCCGGACTCAGA
CCACATGACTATCTGCAAGGCCAAAAGCCGCGAGGAGCCCTTGTACCAGGACGTCCTCGAGTACATTGTGCGGCATGCGGTCTCGTAGCTTGCCGCGATG
TCAGATGACACCTCTGAGGGCCACAAATTGCTATAGCGCCCGTTCGATCACACGATGAGTAACACGCAACATAGAGAACATAGAGCACAGCTGTCCACAT
GGTGATGTTGACGGTTCAACTCGACGAACACCATGAACGCTAATCTCGTGGCTGGAGCTGCTGCTCAAGAGCGAGCAGGGTTCTTCCACCTGCGAGGTGG
AATAGCTCATATACGTTCAGATACACACGCGCAGTTCTTACCGCAGTGCCTGAGTCCGGACCAAGTTAATAGGCCCGTCCTTCATTCAACTGCAGTCAGC
GCTCATTTCGAATATTTACAGCGTGCTGTACGACGAGACTTCCTCGTACCCGACTGCTCCGTGTCGCTCTGCGGGTGGCAATGGGCTGCACGAGCAGTAG
CGCTCGTCGTTCAGCGCTCTCACGACTAGACAAAGTCGGGGAGGCGACGCCTGCCTCGCCGTCGTCGTCATTGTCATCGTCATCGTCACATTCAGAAGCG
CCCGTGATACTCGAGTCCCCGACGTCGTCTACAAGCTATCGCGAAATGTCGTCCAAGACGTCCGCGCCCCGACCCGTACAGCCACCACGGCGCCGATTGC
ACCGCCGTCGCCGACGAGAGCCGCACCTCGACCACCACCTCTCGGACCGATTGGACCTCTTGGCTCGGTACCTGCAGAGAGCATCGAAATTCGACAAGCA
GGAAGCCTTGTATATCCAGACACAGCAAGCCATCGACGACCTGCTCGACAACATTCACAGCTTTTTCATTATTTATGAGGCCGAGAAGCGCCCTCTGTGG
CGTCTCGTACAGACCGGTCGAGTGGTGCAGCAAGTCGAGAGTTTCCACCGAACGCTGGATGCTATCACGGCGAGATGCGGCTTAGCAGTGGTTGCGCCCA
GTGGGGCTGGTCCCTCTCTACCTCGCTGGCAGTCGCGTTGGCGCCGGATGCGAGCGGAGCGTCTCGTATTCTTTCGATCGTATCTCGAGGAGCAGGAGAT
TGTCGCAGTCTCCAACTCGCGAGTCCGTGAAGCTGCAGACCAGATCGAGTTGCTTACGCTACTCAAACATGACGCGCAAAAGTTTGATACTCTGCTGACA
G