Description :
From Genome Similarity Track
Location :
Scaffold_23:799668- 801294
Transcript NameFunction/comments
Aphas_H257_09975transmembrane protein, putative

Sequence
1626 bases(100 bases per row)
AACGCGTGTCGTACATCGCGTCCATCACCAAACAGGCCGACAAGGCTGTCGACGCGTTCAAAGACGCAAGTACCCCGCTGGACCTCGAGGACGGCGCCCT
GCGCGAAGGCGGTCCGCTCGTGTACACCTCCCCTGAAGTTTTGACTCTTCTCTTCCAGTACGCCGTGGTGGGCATTTGCTACGGCGGAATTCCTGGCATA
GGCGTGCCCGTACTGACCTACTACTTTGGCTTGGAGTCGGCCACGCTGAGCTCTGCAAGCGGTCTCGTCAATTTGGGGTGGTCGTTCAAGGTGTTTTACG
GTATGCTCTCAGACTGCTTGCCGATCATGGGCTACAGTCGCAAGCCGTACATTTTGATTGGATGGGTTATGACTGCGATCTGTTTCGTGGTGATTGCGTT
GAAACCGGTGGGTCCGTCGGTGATCGTGGACAGATCGGACGAGAACATCAAGGCCGCGAGGTCCTACGGGTCGGTCCTCGTGCTTCTCTGCGCCCTGGCC
AGCTTCTGCTACATCATGGCCGACGTCGCTTGTGACGCCTTGGTGGTCGAATACGCCCAACGCGAACCCGAATGCGTGCGTGGGCGTCTGCAGTCGTCCA
TCTACGGCACACGTTTCGTCTTCCAAGGACTGACCACCGCAATGTCTGGGTTCCTTATGAGCTCGGAGCGTTACGGCGGCAAGTTTGGGTTTGACATCAG
CGTCAACACGTACTTCGGGATCCTCGCGGTGCCCGTAGTCGTGAATGTGTTTTTGGTGTACTTCTTCATGAAAGACCGCAAGCGCGGCGCCATCCGCTTT
GCCACGTACTTTCATGACGTGTACGAACTCATCCAGAAGCGCGCCGTGTGGCAAGTCATGATCTTCTACTTCATGTTCAACCTGCTCTCGAGCGAGATCG
GATCGTTGGCGGGCAACTACATCCTGGTGTACTGGGCCCACGTCGAGCCCGTCAACAGCGCCGTGGTCCGCGTGATCGCGTTTATCATCTTAGCCACCAC
GGTTTTCGCCGTCGGCCGGTGGGGCACGCACTGGAACTGGCGCTACATTGTGGTCATCACGACATTATCTGGCGTCGTCATTGATGCCATTGTGCAGTAC
CTCACCATCTATGACATCGTGCGTCACCAGTGGTTCTACATTGGCGTCCCTCTCACCGCAGATGTTCCGCAAGCCATCCAATTCGTCGTGTCCACGTTTG
TGATTGTGGAACTGGCGGGAGATGGCAACGAAGGGCTCATATACGGTCTGCTCACGACCGTGGCCAACCTCCCCTCGACTTTTGGAAAAATGGTCACCAA
CGTCTACTCGACGCAGCTCAAAGTGACCAAAGCCGACATTGAGACTGACACGGCAGAAGTCCGCAACCACGCCGCGTACTCGTACTTGGTTGTGTACGGG
ACAACTGTCCTTGCATGCTTCTGGGTGATGATCCTGCCACCCCAAAAGGCCGCTGTCAAGGAAATGCTCCAACACGGAGGAAAGTACCCTATCATAGGCG
CGTTGATCATCGTCTTGACGTTCGTCATCCTTTGTGTCTCCGTCACGGCCATCATGATGACCATGTTTGAATCCACGTCGTGCTACCTCTTGGCCGGTGG
CCAGGGGTGTTAATCAACGCTAACGA