Description :
From Genome Similarity Track
Location :
Scaffold_88:79956- 84650
Sequence
4694 bases(100 bases per row)
GCAAAGCTTCACGTCGCGGTCGCCGTCGTCAACGACGCCACCGCCGCCTCAAGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGC
GTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTGCCCGTCAAGGCATCTGGTGTTCACTTG
GAACCGTTGCCAGAGGTTGCTGTTTTACTAACCCTCGAGGAAATGACGGTTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCCGAGATGGTGC
TCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAGACAGCGTCAGACGCGCTTGGG
TTCTGAGATCTTAAAGCACCCCAAGGGTCCGGTGTATCCTTTGGTAACGGAGTATGCGGACGTGGTGAACAAAGACCCACCGACCCAACTCCCACCGGAT
CGAGGCGTACGGCATGAGATTGATCTCGTGCCCGGCACCAAGTATTGTGTCACGAGGCAGTGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCT
TCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGAAAGCCGAATGGAAAGTGGCGTCC
GGTTCACGCTTAAAACAAGCTGAACAACGCAATGGTGCCGGCCCAAACACCAATCCCACGAGAGGATGTGTTGTTAAACAACATGGCCGGGAGCGTTCTG
TACAGCGCGCTGGATTTGGTAGACGTATACTACCAACTCCTGATGCGGGAGAGTGATATCTTGCTCACCGCGGTGAGCACCTCAAGCGACATGCTTTGGG
AGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGTGACGTTCAATCGCCTGGTGACGCAGCTGTTCCGCCCTTTGTGTACCTTCGTACAGGCGTA
CTTCGACGCCATATTCGTCCATAGCCGTGCCGAGGGAGGCAATACAGCCATGGAGGTGCATCTAGGACAACTCCGTCGAGTGTTGGACGTAATGCGAACG
AGCAAGCTCTACGTCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGCACTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAG
ACAAGGTCAAGGCCATAACAGCATGGCCGACACCCCGATCCCAAAAGGAACTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGG
GTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGCCGACTGGCGCTGGGCGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCT
ATTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCCTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGC
AGGCCGACACGGCTGGACATGAACGAGTCATCGTTCCAGTCCAGGCAGCTCAAAGTCGCCGAGCGAAACTACCCTATCCACGACAAGGAACTCCTGGCAA
TGCAATATGCCCTTGTAAAGTTTCGTGTTCACCTTCCGGGCTCTCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTCGCT
TCACCTATCCCAAAGGATGGCGAGGTGGCTGTTCTTCTTCGCGGAGTACAACTTCCGCGCCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCAGACGCC
CTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACACGGGTGACAATGAATCTATATGATCGGATACGCATGGTGTATCGGGACGATGAGGCTGTCG
CGCCTATCGTCAAGCTCCTTATGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATAGGAGTTGAAGGATGGCCTTCTCTACTACCGGGT
GGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCAGAGGCGCACGACGCGCCCTCCAGCGGCCACTTG
GGTCGCGAGAAGACCTTTCTGTCGGTCGGTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGCTAAGACATGTGAAACATGTCA
GCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTT
CCCGATGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGGTATGGGCGAACAAA
CCGCAAGGTTCTTCGTTGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCGCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAAC
GCTGTTTCCTTTACTGAGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACT
CTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCTACGGTGCTCA
CGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAAGCTCGGAAAGC
CCTTTCCTCCCAGGTCTCGGATGTGATACCAGTTTCGCCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGCCAGCAGGGTCCGCGATGA
CATGGCAGCGGCGCAAGATAAACAAAAGGAGTACTCCGACAAACATTGAAGAGTGAACTTAAGTGTATTTAAAGTGGGGGGCTTAGTGTTACTAGACACG
AGGAGCCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCGATAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCCT
ACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGAC
CCACCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCAGTCGGAACGGCAAGGCTGCGGT
CAAGACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGATACGCACCATTCGCGTACGTCTGGGA
GTGTGCCGCAGCCGGCTCCGGACGTGGCAGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACC
CGCAGATGCAGGCTCGCGACCTCTCGCTTCAACAGGTCCAGGCGGCGCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGC
CAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGCCGGAGCACTCGGACG
AGAGTGGCGTTCGAGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGAT
CCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGATGTGGAGGGGTTATGCTCACTCCGATAACTCGTGGGAACCGATCGAACGGCTCCTG
ATTGACTGCGCGAAGGCTGTCGCAATCTGAAAACAGAAGCGGCGGCAGCTAAACAAATAGTCCGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATAC
ACTCCGTACCCGCGCTCATCGTGAGCGCTGGAAGCCGCACGCTTCAAGATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCGAACACGAC
GATCACGCTGATCCAGGATACGGGACAGCAGCTAGTCTTCATGGAGCTCCCGTAACTCCGTGGGTGAGTACTCGAGAGACTCCACCCATGCCCAGAACAT
GTCCTCACAAGAACGCCAGGTGGGGCAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGCCCACCCCGGTTCTCGGGCTTCTTACGACAA
GTCGTAAAGTCCTTAAGGAGGATGCGGTGTTGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTCGTCAACGAACAGCTGTTCTTTCTGAACAAGGGCAC
GTTCGTAAATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAACCTCTAAGAATAGGACATCCCCAGAGCTCTCCTCGGGAGGCCA
ATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGGCCACTACCAAACCCCCACGCACACGCTGGGCAGCTTGAAAGTCCTCCTGCTGCTGGTCGA
GGTCATTCGTGACCTCCCGGGGTTCAGAGATAGCACCCTCCTCCTCCTCTTTTTCCTCCTTCTTTTCCTCTTCCTCCCAGGAGTCGAAGATGCC