Description :
From Genome Similarity Track
Location :
Scaffold_690:7993- 10364
Transcript NameFunction/comments
Phypl_g10343hypothetical protein

Sequence
2371 bases(100 bases per row)
AACGCTATTTGGAGACAGATTGGGAAAGTTTTCGGGCGAATCCTGCCTTCGACCTGCTGACGAAGTACAAGGACAGCGTGTTCCGCCCTGAACTCCCTGA
AGGTTTTCCAGAGAAGCGCGACATCGAGCATCGGATCGATGTGAAAGATCCCAATCTTGCAATGTATCGGCAACAGTGGCGGCAGTCacctgagcagcag
cgtgaaaTCGTTCACTGGGTTGAGGAcatggtgaagaagaagctcattCGACCAAGCATCAGCCCACATGCTGCTCCAACTTTCTGCGTCCGGAAGCCAG
TTGGTTGGCGGATCGTGCATGACTATCGGTACTTGAACTCCAACACGATTCGCCAGAGCATTCCAATGACCCGGACAGAAGATATCTTGGACGCAATGGC
TGGATCATACTGGTTTTCTACGATGGACTTGATGTCAGCGTACTACCAAGTTCGCATGCGTGAAGAAGATACCAAGTTCACCGCATTCCAGTCGCCAAAC
GGACTCTGAGAGTTATTGGTCCTGCCCATGGGAGCCTGCAACGCGCCAGCGATGATGCATCGGTTGACGTGAAAACTGTTTCGTGAGCTCGAGAACACGA
AGTCGATTTACGACGACATCTACATCTTCACAAAGTCGCGGAAGATCAAAGTTCACTTGGAAGCTCTCCGCCAGACCTTGGACATCTTGCGTGACAACAA
GTTGTACGTGAAACTATCCAAGTGTGTTTTCTGTGCAGATGAAATTCTATGTCTCGGAGACTTCGTGGGGCGGAACGGCGTGCACATGGATCCGGACAAG
GTCCAGACAATCAAGGACTGGCCTGTCCAAAGAACGCAAGAGGAGCTTCTCAGCTTTCTTGACTTGACCGGCTACGTCCAGCGCTTTTGTCCAGACTTTG
CGGCGTTAACGGCAAGCATGTTCAACCTcctcaagaagaaaaccAAGCGCAACGCGAAGATCCATTTCGACGAAGAGCAGACAAAGCATTTCAAGGAGCT
GAAACGACGGCTGTGCAATCCACCTGTGTTGCACCTGCCCGACTTCAGCCAGCCCATGCATCTGCGTACGGACGCTAGCAAGTTCGCTGTCGGGGTGTCC
TGTTCCAAATCGTCGATGGAGTTGAGCAGCCGATCGCGTATACGAGTCGGAAGATGAAATCAGCGGAGCTCAACTACccgacacagcagcaagaactgTT
AGCAATTGTACATGCACTTACAGCGTTCCGGATATACTGCTTGGACAAGCCACCGATCGTCGAGATGGATCACAAAAGTCTCGAAGGTCTCTTCACTCAG
AAGATGGCTAACCGTCGACTAGCTCGCTGGTACGATATCCTTGCTGAGTATCAGCCAACGTTCCAGTATCTACCTGGTGCGAAGAACGGAATTGCTGACG
CGTTAAGCCGGAGACCGGACTGACAACCGGAGAGCAAGTACTTCCACGACTTGAGCGTGACAAGCTTCGATGACACATCATTCAGCATAGGGATCAGTGA
AGTGACCAGTGACACCGAGCTTGTGGCAAAGATCAAGAAAGCGTATGAGAAAGATCGAGAAGCGCAGTCAATCTTCACAACAATCAAGCGACGCACAGCG
CCCAGATCATCACGTGGGAGACGCCGAAACCTGAAGCAGTATCGTTGCTACTTCGAAGAGAACGGTCTGCTCTGGTACCAATCTCCTGTCGATGACGTTC
CACGCGTTGTTGTGCCAAACAATGCCAAACTACGACAGCGGATCATCAGCGAATGCCGTGAATCCAACTATGGAGACCACCCAGGTGCAGAGCATACGCA
GCTGACGCTCGCACGGCGATGGTACTGGTCGAGGATGCTGAGATCGATCCAGAAGTTCATAGCAGATTGTGAGCAATGTCGACATAACAAGCCTCGGTTG
ACCAAACCTCCTGGTTTGCTTGAACCCCTGAGCATTCCGGATGAGCGTTGGCGATCAATCTCGATGACCTTCATCACGGACTTGCCGCGAACGAAGCGAG
AGTTCGATTCCATCTGGGTAGTCGTCGATCGCTTGACCAAGAGATGTCACTTTGTCCCGAGAatcaagaaggtgacggcGGCAGAAGGTGTTGCTCGACT
CTTCATCGACAACATTTGGAAGCTTCACGGAATGCCGACCAATATCGTGTCCGATCGCGACAGGAAGTTCGTCTCTGCCTTCTGGCAGCACGTGTTCAAG
TCCGTTGGAACGAAGCTCAGCATGACAGTAGCGCATCGAGCACAAAGTGACGGTCAGACTGAGCGAATGAACCGAACACTTGAGGAGTATCTGAGGTGTT
ACATAGGACCTTTTCAAGACGACTGGGATGTCCATCTCGCGAACGCTGAGTTTGCTGTGAGCTTCACGGTG