Description :
From Genome Similarity Track
Location :
Scaffold_371:7992- 11771
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_371-fgenesh-gene-0.1Mahogunin, ring finger 1
Pytiw_DAOMBR242034maker-piw_contig_371-snap-gene-0.11Protein kinase

Sequence
3779 bases(100 bases per row)
CATGGGACACACTGGTAGCGTGCAGCGCGGTGCACGACGCGCCAACCCGAACGATGCGCTCTATGGCGAGCCCCTGGGGTTGCACCCGGCGGGGGCCGTC
AACCGCGCCGACTACTCACCCGCGCAGCTGCAGGCGCTCTACCTGAGCCGCGGGCGGCCGGACATGGGCTTCATGTCCAACCAGGCCATGCTGCCCAAGG
ACGTGCCGGAGATGCAGCAGACGAGCACAGTCAAGAACCACGTGAACCTGCAGAAGAGCTCGCTCAAGCTCGTGCCCTTTGAGAATGGTGGCTCGTCACG
ACCGCTCGTAAGCCTCGAGTTCCAGTTCGACGCGACAAAGCCCTGCCGCGTCACGGTCTTCCTCGTGGCGCTCGAGGAGATCGACGACGACACGGGCTGT
TCGCGATACTCGCAGCAGCACAAGGATATCCCGGCGCTCTCGTGCGACTTCCCCGAGGGCCTCTCACAGAAGTTCAGCCTCCTGGAGCACCTCGCACCGA
CGATCGAGACGGACGCCGGCAGCACCGAGGAGCTCTTTGACCTGAGTCGGTTCAGTGAGAGCGAGCTCATTTACCAAGAAGGCACGCTCAAGTTCCCGCT
CATCATCATGCTCGAGGTCCTGGACAACAGCAGCGGTGGTGGTGAGAGCGACCGCTCGACTAAGAGCGCGCCGCAGTCGCAGTCCACGTTCTGCACCTTT
GCCAGGCAGCCCAGCATCACTGGCGGCTGGGCCATCAAGATGCTCAAGCAAAAGATCCAGGTCGACGGGCTCACGTACGAGCTCCAGGAGATCTACGGTA
TCGACGGCTCGCTGACCGCCGCGCCAAAGAACGACGCCGGCAACGGTGGCGGCGGTGAGAATCCCACGGGCAACAAGAAGGGCGCGCTCGACGAAGTTGA
GATGCCCGACGGCGCCGAGTGCATCATCTGCATGTGCGAGGCGCGCAATACGACCGTGCTGCCCTGTCGCCACATGTGCCTCTGCAGCGAGTGCGCCGAG
GCGCTGCGCAAGAACTCGAGCACGTGTCCGATCTGCCGGACGCGCGTCGAGGGCCTGCTGCAGATCCGCGTGGACGCCAAAGACCAGTCCGACTCCAAGG
ACTGAGAGCTCCATTCAGGTTTTTATCACCCACCCACTCACCGCTAGGAACACGCTGACAGGAGACACGAGACTGTACACGCAAACTTGTAGCTTCTTGT
TTCTTTCTTCACGATATCTAAGACTGGCGCAGCAATCCGCCCATTTAAAGTACTCGACCACTTCTTCTCCTCTGCTCTCTGGGGACTTCTCTCGTCGGCT
GGCTCGTGTCGAAACTTCTCTAATTTCTTCGCTCTCATGCTCTTCTTGTACACACGCGCGCCACTCTGCCAGCTCGTCCCTCGTTCGCTTCTCTCTCTCT
CCGGATGCTGAGCTGCACCAGTCCAGTGAGCATCCAAACCAATCTCCAAGGCTGGTAATTCAAACGTAAACAAAACTAAGTAGATGTACTGCCACCAGGC
ACTGTCGACTCGGACTCGAGGTGTTGCAAGCTGAAGTCGACTTGAACTCACTGGAGAGCTCTAGTTCTTCTTCCACAGGCCCTTCATCTGAACAACACAA
GCAGCAAACAGACAGGTCAGTTTGACACAAATTCAAGGCGACATTGTGGCGACAACAATTTCGAGCGTACCAGACTCGCAATCTGCTCAGGGGCGTCGCG
CGCGCGCGACAGCGAGCTTGTGGGAAGACTACCGGCCTCTGCTCCGACAGCGGTCTGCTGGGCTGGACTGCCGTTGCCAGACTTGGAGTTCGCTCCCAAA
GCCGAGTCACTGTTGCTGTGCAGAAACACGCGTGGTCTTCCGGGAGTCCCCGGGTTCGGACTGGAAGATACGGGCTCCTCCAAGTACTGCTGCTGCTGTT
GCTGCTGCGGTATCTTGAGTTGGAAGTCTTGGTGATACTCGGCCAGACTGTGCATCCCACCTGAGCGTTGACCGGCGCCGTGGCCAGGACTGCCCGAGTT
GTTGTTGCTATTGTTGCTGTAGTTGTTGTCTGCGCTAGAATTCGAACCGTCCGAGGTCGTGGGAGAAGAAACCTTGGCACTTGCCACTTTTCGGCTCATC
ATGTCGAACCTGTGATGTATTTCGTGGGGGGGGGTTTAAAATTGCACAGCGTCAGTGCACTCACTCACTCCTTGCTGGTGGTTCTTTCATACAAATCGCT
TCTCTCGCTATCCTCAGACGTACATTTGCTCACGCTTCTTCAGCTCGCCCTCGCGACGAACATAGTCAATCTCCAGCTCTGTAAGACATCATGTCAAACA
GGATATCACAACGGTATGAGCACAGCAGAGTCACGCAACCAGCGGTCGTACCATAACAGTTTCTCACCTTTGAGCTTCTTCTCACGAGCGATCAGTGCGG
CCTCTTGGCGGCGCAGGTCCTCTTCGATCGCTAATAGCTCCTTCATCTTCTGGCTGTACGTGTTCTGCAGCTGCTGTTCTGGTGAGGGGGCATTGGCTGC
AGCGTACGCTCGCAGTCGCTGCTGGAGCTGCGGCACGCGCTCCAAGTCCTCGATGCGAGGTCGTCGCGAGCGCTGACGGTGGAGCATCCACCGGATGACC
TGGAAGAGGCCCTCCGAGTACTGCGCGGGGATGCGCGTAAATTTGCCCGCGTTGATCTTCTTGGCGAGCGCGAGCTGGTTCGTGGCGTCGAATGGCGGGC
TATATACATACAGCAATGTGAAACAATTGGACAAAAGTAGGACACCATGCTCACGAACAAGTTTACGTACGCCAGCGTCGCCATCTCGTAGAGCAGGCAG
CCAAGCGCCCAGATGTCCGAGCGCTCGTCGTACGTCATCTCGTTCACCATCTCCGGACTCATGTAGTACGGCGTGCCGACATTCGTTTGCGCAAAGCGCG
ACTCGCTGCTCAGCTCCTTCGCGAGCCCAAAGTCGCCGAGCTTGGCGTTGTTCTAGTGGGCCACAACACTTGGTGAGCCAAACAGACACACGAAGACAGG
GTCATGGATCATTGTCTGGCACACGTACATTGGAGTCCAGAAAGATGTTGCCCGGCTTGATGTCGCGGTGCAGAATCGGACGCACGACGTTGCCCTCGCG
GTGGCGGTGGCACTCCTTCAGCGCCAGGAAGATGTGTGTGAAAATGTGCCAGATGAAGCCTTCCTCAATGTACGACCTGGCATATTTTGTATGAACAAGA
GTGGCACCTGAGTAAGTACGAGAGACACATACAAGGCCATCACACAACAAGATAATAGACGCACCCTTCACGCTTCTTGCGCTTGATGTACTGGCTCAGG
TCACCGCCCTCGCAGTACTCCATGACGATGTAGATCTTGGTCGCCTGCTTGTCAATCACGCGGTCCAAGTAGCGCACGATGTGCGGGTGGCGCAGCTCGC
GCAGGATGTTCACCTCGCTCACGATCAGCTGCTTCTCCTTCTCGCTCATCTGCCCATAGTTCACCTCTTTCCACACGAGCGCCTGCGCAAACAATAAACC
ACACACCCGCCTATCAGTCCATGTCCGTAGGTGCCATGTCCACACCCATTCCTTCACACGCACGCACTACATGAAATGAACACGAGAGCGAAGCCATTTC
ACACGCCGCTCCGTGGACGCGCAGGCGGCCAGCCATCGACACGTTCCACATCTCACGCCCACACATGCATACGCACTCAAGAAGAGAGAACGCACCTTGC
CGTCGGCCTTGCGCACGATCTGCGTGACCACGCCGAACGAGCCCTTGCCGATCACTTTCACCTGCTCGTACGCGTCCAT