Description :
From Genome Similarity Track
Location :
contig_13:799134- 802729
Transcript NameFunction/comments
g2969.t1XP_002905240.1 rRNA 2'-O-methyltransferase fibrillarin, putative [Phytophthora infestans T30-4
g2970.t1hypothetical protein

Sequence
3595 bases(100 bases per row)
CTCTCTTCTCCCCAAGAATCTCAAGTATGTCTGGACGTGGTTTCGGTCGTGGTGGTGCTCGCGGTGGCCGTGGCGGTGGTCGCGGCGGTGGTCGTGGATT
CGGCGGCGGTCGCGGTGGTGGTCGTGGCGGCGGTCGTGGCGCTCCTGGTGGCCGCGGCGGCTTTGGTGGCCGTGGCGGTCGTGGCGGTGACCGCGGTGGC
CGTGGCGCTGGCCGTGGCCGTGGAGGTGGTGGTCGCGGCGGTGGCCGTGGCGGCATGGCCGGCGGCGCCAAGGTGGTTGTGGAGCCTCACCGTCACGCCG
GCATCTTCATTGCTCGCGGCAAGGAAGACGCTCTCGTGACGCTCAACTCGACGCCCGGCAAGTCCGTGTACGGCGAGAAGCGCATCTCGGTGGACGTGCC
AGCCGCCTCGGGCGAGGGTACCGAGAAGGTCGAGTACCGTGTGTGGAACCCGTTCCGTTCGAAGATCGCCGCCGCCATTCTGGGCGGTGTGGACAACATC
TGGATCCAGCCTGGCGCCAAGGTGCTGTACCTCGGTGGTGCCTCTGGCACGACCGTGTCGCATGTGTCCGACATTGTGGGACCCACTGGCGCCGTGTACG
CCGTCGAGTTCTCTCACCGTGTGGGCCGCGACCTCATTAACATGGCCAAGTCGCGCACCAACGTGGTGCCCATTATCGAGGATGCGCGTCACCCGCTCAA
GTATCGTATGCTCGTCCCCATGGTCGACGTTGTGTTCGCCGATGTTGCCCAGCCTGACCAGGCTCGTATCGTGGCCATCAACGCCTCGCACTACCTCAAG
AACGGCGGTCACTTCGTGATCTCCATCAAGGCTAGCTGCATCGACTCGACGGCCCCGCCTGAGGCTGTCTTCGCACGTGAGGTCAAGAAGCTGCAGCAGG
AGCAGTTCAAGCCGGCAGAGCAGCTGACGCTGGAGCCGTACGAGCGTGATCACGCCGTGGTTGTGGGCTCGTACCGTGCCCCCAAGAAGGAGAAGAAGTA
GCTTCGCTCAGGAACAAGCCTCATGGTTTACACTCTCTAACTATGCAAACTGTTTTTCTACATGCTTTTGTCTTGTAGGTCTCCGCCTGGACATGTGAAG
CCCTCCTCTTCTTTTCGAGTCTCCTACCACGATTCCAAGCTGCGCTCTTCCTCGAGAGATGTCGTCGTGGGATACCATTGATCTGAGTGCGTTTTGCATT
TTTGCATATGAGTGGGGCGATTCCAACGAGGCCTGTTGCAAGGCGGCCTCCGACTTTCTCGATGATTAGAAGTATTGCGTCGGGCGGACTGAACAAAACG
GGGCTTGTTGCCGTTCCTCACCCGCTGAAAAGTGGTCACTGGGGTCGGCGGTGGGTCCTATCCGTGATCGAAAGACGTCATCAAAACCTCCAAGTGGGGT
CGATGAGAGAAAAGAAGGGCAAATGTTTGTATATCTGCATGTGTAGTCTTAGCTAGTAGTCCTGAGGAAGAGTGCAGCGAGAAGAGGGGTGGCCAACACA
CCAAGGGTGGAGACCTGTCCGTCTTTCTTCCTGATCAGTTCGCACTGGCGTCTACTAACATGTCGTACATGCAGCCTAAACAAGCAATACACGATAGTTT
CACCGGACTTCCTCTTCATCTATTGTTGGTGCCCTGTCGGAACCAAAGTCGCAGGGTTGCATTTGAGCTCGTTTTACCTTCCTCCTAGCCCGCTATGCAC
CGAGTCAGCGACCAGCTTCGAGACCGCCACCCGTACGCGGACCAACCTTTTGAGGAGTCCTTCAACCCGAAGGAGGTGGGTAGTCGGAGATAGTAAAATG
CTCTTCGAGAGACATGTGTTGGCTCAGTCGCTCATGTACTCAGGTGACGCGTGCGTTCGGCGCTAGAGCAATTCCGAAATATGCCGAGTTGCTGGCGACG
GAAGATCTCCCCGACGAAGACCGCTGCCGAGCACTTTATGACTTGCGCGAGCTGCTTAGCAGTCCAAACTTCAAGTACACGGCTGTGATGCGGGAGCTCA
TGTTCACGTGTGCAGACCTAACGCAGTCGATCTCTCCTGAGGTTCGCGCGGACGCTGCGCTGGTGGTTGCATCACTGGTACTGTTCGAAATGGTAAGCTT
GCGTTGCATTTTTCATTCGTGGCAAAACCACACATGGAGTAGTCACTGAGCTGTTGCCACACGAGCAGGACGCGCCAAACGACTTGAGCGACGAAGTTGT
GCTGACCACGGCGACTCGATTGCTAAGCGATGACGAAGAAGCGGTTGTCGCTGCTGGATGCCGCATTTTCATCAACTTGACGGTTTCTAACGAAGGGTGT
CTCCTGCTCGCCAACAAAATTGAGGCCGTCGCCACTTTAGCAAAGATGCTATCTAGCCAGCCGCTGTCGAAGCTCCCACCACAAATTGTCGAGTTGCTCG
TGGAGGTGCTGGCCAAACTCACACGGGTCTACGAGGGTGCTCGTACCTGCGCACAATTCACCATTGTAGCGCCGGTGCTGTCGCTGCTTAAAAAACCGCG
GCTGTGCCGAGCTGATACGCTATTGCACTCGGCGATGGTGATCACGAATGTGGCTGCATACGACCAAGCCAAGCGAGAAGCCATTCAGCTCAACGCCGTG
GAGTTGTGCCTCAAAGCGCTCTCGAAGGTCCTTCTAGGACAAGTGCGTTGTGAGCCGGCTGAAAAGCGAGATGAGCTCACTCGATGCCTCACTGCAGCGG
TGATGGCGTTGTCAACATCCGAGGACGCCAAACCACGCGTGATTGAATTCGGTATCGAGCCGTTGGTACAGTGCTTGGCTCACACGAGCGCATCTGTGCG
ACAGAATGCCAGCATTACCATCAACTCGGCTTGTGATCTGCCTCGTGGCGTAGTTCCGTTCACCCAAAGACTTCTCCACGCACCAGACCTGTTGGTTGAT
GTTATGGGCATCAAGTCCGTGTCGGCTCTGAACAAGAGCGTGAATAGCTTCAATGACGAGGATACGCCTGCCGCACTAATGGCGTTAGCTGCACTGCAGA
AGAAAGACGTGTTTGGAACTGCAGACCGCGTGGTTCAGACCCTGGGCATGCTGGACAATCTCGTCAAGCTCCTCAACGAAAGCGAGGTGCCCGCCGAAAC
CCAGCTTGGTGTCGCCGATGTACTGAGACGAATGGGCCAGACCGACTCCAGCTATCGACGGCGCGTGGGCAAGTGCATGATAAAGCACAGTGTCTCCGTA
TCGCAGTTCGTGCAGATCGTAGGCCTTCCCCCGGCAGCATTTCTCGAGCAAGTTGCGTAGCCAGCAGCTTTACTTTGGGACGTGCTTTTTTTTTCATTGC
ACTTGGATACACTTATGATATGTATTCAGAGAGGGTATATATTGATAGAGGTGAAGAATAGCGACGGCAGGACGTCCTTATAAAAAACAAGATGTCGTGT
CCAAGGTGGTTTTGGAGGTGGCGACCAAGCCAAGCACTAATACACATTGCGATTGCAAATCTGCTCTTGTGTTCGTTGAGCCGAGAGAAGGTTAGCATCT
CCCTCGACAAGGACGGGATTGCGCGTATGCGTATCCAACCACTGGATGGTTTAAGCTCTGTCCTCCTTCGTGAAGACATCTACCAGTTTTTTTCT