Description :
From Genome Similarity Track
Location :
Scaffold_1:799047- 803493
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_00314ABC transporter lipid export ABCA family

Sequence
4446 bases(100 bases per row)
CGCTCATCACCGAGAAGGAAAACAAGTCGCGCGAGCTCATGAAGATTCTTGGTGTCCACGACCGCGCGATCATCTGGTCGTGGTACATTACGTACGGCGC
CATCTTCGTCGTGGCCGCGATCCTCCAAGCAGTCGCGAGCAAGGCGAACCTCTTTTCCAACTGCAATGTCGTGCTCGTCTTCATCTTCTTCCTACTCTTT
GGCTGGAGCGTTCTCGCGTTTGGCTTTATGGTGTCGTCGGTCTTTTCCAAGTCCCGCATCGGCACGTACGTCGGCATCATCCTCTTCTTCGTCATGTACC
TCATCACGTCCGGCTTCTCGGCGACGACCGCCGAGTCGACCAAGAACGCCATGTGCATCTTTGCGCCGGTGGCCATGGCGTTCGGTGTCCAGACGATGGC
TAACGCGGAGGCGAGCTCCCTCGGCATCACGTTCGGGAACGTCAACGAGCCGTACCAGAACTTTCGGTTCTCGACCAGTCTCTACTACATGGCCTTCGAC
ATTGTGCTCTACACGCTTCTCGGCCTCTACCTTGAGAAGGTCGTGCCGAAAGACTATGGCATCACGGAGAAGTGGTACTTCCTCGTCTCGCCGTCGTACT
GGCGCAACAAGCGCAGCGCTGGTTCCGTCCAGACCAACCTCAACATCGACGACGCGGCGTACGTCGAGGGTGCGGCCCATGACGCCATCGAGCCCGTGGG
CATGGAGCTCAAGGCGCAAGAGGCAACGGGCGAAGCGCTCCAGATCCGGCGGCTCCGGCGCGAGTTCAAGGTGCCCGGTGGCACCAAGGTTGCCGTGCAC
GGCCTCGACCTCACCATGTACAAGAACCAGATCACGTGTCTCCTTGGGCACAACGGTGCGGGCAAGACGACTCTCATCTCGATGCTCACGGGCATGATTC
CGGCGTCGGGCGGCGACGCGACCTTCAACGGCCTCTCGTTGCGCAACGACCTCTCGGAGCTGCGCCAGTCACTGGGCATGTGTCCGCAGCACGACGTGCT
CTACGCAGAGCTGACGGTCGAGGAGCACCTCATCTTTTACGGCCGCATCAAGGGCTTTTCGGGCAAGGCGCTGACGGAAGAAGTCGCCGACAAGATTGCC
GAAGTCGGCTTGACGGAAAAGCGACATGTGGCGTCGAGCGAGCTCTCGGGTGGCATGAAGCGCAAGCTGTCACTGGCGATCGCACTCCTTGGTGACAGCA
AGATTGTCTTCTTGGATGAACCGACGTCCGGCATGGACCCGTACTCGCGCCGGTCCAGCTGGGAGATCATCATGAACAACCGCATGAACCGCATCGTGGT
GCTCACGACGCATTTTATGGACGAAGCCGATATCCTCGGCGACCGGATCGCCATCATGGCCGAGGGACAGCTGCGCTGCGTCGGCTCGTCGCTCTTTCTC
AAGAACCGGTACGGCGCCGGCTACAACTTTGCGCTCGTCCGCACCGAGACGTGCGATACGGCGGCGCTCATTGCGTTTGTCCAGTCGCACATTCCGGTCG
CCAAGGTGCTCTCGAACGTCGGGACAGAGATGTCGTTCCAGCTGCCGCTCGACCACGCGCCGTCGTTCGCGGCCATGTTTGCGGACCTGGAAGTGCAGAG
CAGTGCGCTCGGTGTGCTCTCGTACGGTATCTCGGTCACGACGCTGGAAGAGGTCTTCATCAAGGTGGCGGAAATCGGCGACGAGCACCAGCAGCACACG
CTCCAGCCTCGCAACGATGCGGGTCCGCTCCTCTCGCCTGCTGGCTACAAGATCAACACGGCCGAAGCGCCGCCGAGCCGGCTTCGCATGTTTGGCCGCC
ACTTTGTCGCGCTCTTCAAGAAGCGTTTCCGCACGGCCAAGCGGGACAAGAAGATCGTGCTCTTTGGCGCCGTGCTGCCCGTCGTCTTTTTGATTCTCGG
CATGTGCATTCTCAAGTTTAGCTCGCTCTCCAAGAACGACACCGCCATGTCCATCAACCTGCAGAGCTACGGTAGCATGACCTCGGTGCCCGTGACGTGC
CAAGGCGACGCGGCGTGGTGCGCGGCCTTCCCAGCGGCCTACGCGGCCGGCAAGGCTTCGCTCCTCTCGGTGCCGACGCCTGCGTACCCGACAAACAACC
CGACTGTGTTTGACATCACGTACACCAACCCGGCGATCGCAGCCAACGACACGACTGGCACGTGCCTCGCCACTGGCTACGAGGTTTACCAGCGTGGCTA
CGGCGGGGCCGGTGCGTCGCCGGTGCTCGGTCAGTATGGTGGCTACGTGCTCCAGGCGTCGTCGGTTGACAACACGTACGGCTACAACGTCTTGGTCAAC
ACGACGGCTGTGCACGCAGCACCCAACTACAAGGCGGCGATCGATGAGACGCTCTACCAGCTTTTCACACAGCAGCCTGGCATCACGCTCAAGGTGACGA
GCCACCCGCTGCCGCTGACGGCGATGACCAAGACGCTCTTCACGACGTTCATGTCGTTTGCGACGTCGATCTTTGTCGTGCTTGCGTTCGCCTTCTTTAC
GGCGTCGATCGTCCCGTACCTCGTCAACGAGAAGCACCACTCGCACAACTCCAAGCACCAGCAGCTCGTGTCGGGCGTGAGTCTCCCGGCGTTCTGGCTC
GCCAACTTTGCCTGGGACATGATGCTGTTCATGATCCCGTGTGTCATCGGTCTCGTTGCGATCTACCTCTTCGACATCACGCCCTTCACGGGCAACGACT
GCTTTGGGTGCGCGGCAAACCCGTTTGGCGCTGTGATTACGCTCTTTGTGCTTTTGGGATTTGCGCTCTGTTCGTTCTGCTACTGCCTCTCGTACCTCTT
CTCAGAGCCGGCGTCGTCGCAGACGTACACGATCATGACCAACATCGCGCTCGGGACCGTGCTCATGACGGTCTCGATCGTCCTGGATGTCATCGAGTCG
ACGAAGGACATCAACCCATCGCTCAAGTTCATTTGGCGCCTCTCGCCGCTCTTTTGCGTCGGTAACGCGCTCAACCAGCTCAGTATCTACACGATCCGGT
CGACCTTTGGCCGCACTACCAAGGAAGTATCGTCCTTCAGCACGGACGTCATTGGCTACGAAATCATGTACCTCGCCATCGAAGCCGTGCTCTTCCCGAT
TCTTGCGATTGGCATTGACTATGCGCTCAGCTTTCCCAAGATCAAGGCCAAGCTCTCCAAGGACCCAGTCATCGTCGACGCGCCGGTGGACATTGACGTT
GACGTCCAAGCCGAGGCGGATCGCGTCAACAGCGGTCGCGCCGACAACGACGCCGTCGTCATGCGCAACCTCCGCAAGGTCTACAAGGGCGGCAAGGTCG
GTGTCTCCAACATCGCGCTCGCGCTGCCCAAGGGCGAGTGCTTTGGGTACCTCGGCATCAACGGCGCTGGCAAGACGTCGACGATGAAGATGATGACAGG
CGACGTGCTCCCAACCTCGGGTACGGCGACGCTCGGCGGCTTTGACATTCTCTCGCAGCAGATCGAGGTGCGCCGGCTCATGGGCTACTGCCCGCAGTTT
GACGCGCTCATGGATCTCCTCACGGTCCGCGAGCATCTGGAGCTCTTTGCGGCGATCAAGGGCGTGCCGTCCGGTCGCATCAACGACACGGTCGCCGAGA
AGATGACGCAGATGAACCTCAACGACTTCGAGCACAAGCTCGCGGGCACGTTGAGTGGCGGCAACAAGCGCAAGCTCTCGGTGGCGATCGCCATGATTGG
TGCGCCGCCCATCATCTTCCTCGACGAGCCGTCCACGGGCATGGACCCGGTCTCGCGCCGCTTCATGTGGGACGTCATCGCCGACATCTCGACGCGCTCG
AAAGAGTCGACGATTCTCTTGACGACCCACTCGATGGAAGAGTGCGAAGCCTTGTGCACGCGCGTCGGCATCATGGTCGGTGGCCGCCTCCGCTGCCTCG
GCAGCATCCAGCACCTCAAGCACCGGTTCGGCGACGGCCTCATGATGCACATCAAGCTCGCGCACGTCCCGGGCGATGCGATCATGGACTTTGTCGAGCA
CGAGTTTGGCGCGACGCCGACTCTGAGCCTCGAAGACGCGCAGGAGGCGTGCCGCCGCCTCGGCAAGCCGCAGCGCAGCAGCTGCATCGCGATGGACCAC
GCGACCGGGTACACGCTCATGGAGTCGATCACCAAGAACCAGTACATTCGCGCCCGCGACTTTTGTACGTGGTGGCTCACTGAAGACCGGTTCGAAGCGT
TCAACGCCTTCTTGGCCACTGCGATGGGTGCCGGCCATGCGCAGCTGCTCGAGCGCCAGAACGACGTTGCGCGATTCAAGCTCATGAGCCCGACCAAGCT
CCTTCTCTCGCCGTTTTTCGATGCTCGAGGGCTGCAAGGCCGCGTACCACGTCGAAGAGTACACGGTGGCGCAGACGACATTGGAGCAGATCTTTAACAG
CTTTGCGAGCCAGCAGACGCAAGAGAAGGGTGTTGCGCGCGGCGTG