Description :
From Genome Similarity Track
Location :
Scaffold_1384:799- 1865
Transcript NameFunction/comments
g15754.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTGTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGA
CCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGC
GCGGGATCAACACATGCTGGCCTTGTCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCA
CAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATACCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTG
AGTACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTT
CGTTGATACGATGGGCTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACAT
CTCGTCGATCGTGCGCCGCATACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGT
GGAATCTTCATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCAC
TATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGT
CTCTGTAGCCGAGCCGCCCTTCACCACCTGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCAC