Description :
From Genome Similarity Track
Location :
Scaffold_35:79884- 81163
Sequence
1279 bases(100 bases per row)
CTCCTCCGACACGACCGGTGGAAGAGTGTTATCACATCTTTGATGGCGAGACCTGTTTACTCGTCAAGGTATCTGGTGTCCACTTGGAGACGTTGCCAGC
GGCTGCAGATATACTGAGCCTCCAGGAAATGATGGTCCGGTCTTTCCTGGCTACCCTCAAGGCTGGGGAGATTGCCGAGATAGTGCTCATAAGATCAGAG
GCCTTTCGGGAGGAGTTGAACTCCTTCTCTGTCTTGAACGAGGACATCCTAGAAGAGTTGAGCAAGCAGCATCCGTCGAGCTTGGGCTCTGAGATCGTCG
AGAGCCCCAAGGATCCGGTATATCCGTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGATCCAACTCCCACCAGATCAAGGCGTACGGCA
TGAGATCGATCTCGTGCCTGACACAAAGTACTGTGTCAGGCGACAATGCCCTCTCCCACGCGAATAGTGCGAGGTCATTGATGCCTTCTTCGCAGCGAAA
GCGAAGGCACGCATGGTGCGGGAGTCAAAGTCCCACACTCGACGCCGACTTTCCGCGTTTGGAAGCCGAACGGGAAGTGGCGTCTGGTTCACGCTTATTA
CAAGATGAACAACGCGCCGGTGCCGACCCAGACACCAATCTCACGAAAGAATGTGTTGTTGAACAACATGACCGGATACGTGATGTACAATGCGCTGGAT
TTGGTAGACGGATACTACCAGATTCTGATGCGCGAGAGCGACATCCCGCTCACCGAGATGAGCACTTCAAGCGGCACGGTTTGGGAGTGGCTCGTCATGC
CGCAGGGCTTGTCTAACGCCCCGGCGACATTTAACCGACTTGTGACGCAACTGTTCAGGCCATTACATACTTTCGTACAAACGTACTTTGACGACATCTT
CGTCCATAGCCGTGGAAAGGGAGGCAAGACGGTCATGTAGTTGCATTTAGGCACCTCCGCCAAATGTTGGACGCGATGCGAGCGAACAATGTATACGCCA
ACATCGACAAGTGTGTCCTTGCGTCACCAGAGATCAAGGCTCTCGCTTGCTTCGTCAGCAACGTGGGCGATCGAGCTGACCCAGACAGTGCCAAGGCCAT
TGCAGCATGCCCAACGCCCTGATCTCAGAAGGATCTTCGAAAGTGGTTAGGCTTAGCCAACTACCTTTACAAGTACAGCGCAGGGTACGCGGGCCTTGCT
AAGCCTTGTCGGGCCTCCTTCAGAAGGACGCCTACTGACGCTGGGAGCAAGAGCACCAGGATGCCTTCGACAGTCTTAA