Description :
From Genome Similarity Track
Location :
Scaffold_871:7987- 9500
Transcript NameFunction/comments
Phymu_g12223hypothetical protein

Sequence
1513 bases(100 bases per row)
CAGCCGTCCCCCGAggtcttcgagctgttcgacgacgtgttTCTGATGCACGGCGGCAGTGTCATGTTCCACGGGAAACGCGAGGACGTGGTGCCGTATT
TCGAGCAGATGGGCTTCAACTGTCCGCCTCGCAAGGACGTGGCCGATTTCCTTTTGGATCTCGGCACGAATAAGCAAGACGCGTACGTTGTAGGCGGTCC
GGCGAGTGTGCCAACTCAATCAGCCGAATTTGCAGAGCGCTTCCGTGAATCGTCCATCTTTCacagcacgttgaagcgccTGGACTCGCCAGTCAAGGAC
CAGCTTGACATCCGCGACGTCCAGCCGTTCCGTCTGACTTTAGTTGAGGAAGTCGTCACGCTATTGCGTCGTGAACTGACGCTGAAATCCCGTGACACTG
CGTACCTCGTGGGCCGTGCCGTTATGGTTACCGTCATGGGTTTACTGTACGGCTCGACGTTTTGGCAGATGGATGACGCGAACAGCCAACTGGTTCTGGG
TCTGTTGTTCTCGTGCGCGCTATTCGTCGCATTGAGTCAATCGTCCCAAGTCCCGACGTTCATGGAGGCTCGCTCGGTCTTCTACAAGCAGCGAGGCGCC
AACTTTTTCCGTTCCAGTTCGTACGTTTTGGCTATTTCGCTCTCTCAGATCCCCATGGCCGTACTGGAGACTGTCGTGTTCGGATCCATCACGTACTGGA
TGGGAGGGTACGTCGATGCCGTCGaccgcttcgtcgtctttgtGGTTACGCTGTTCTTGTGCCAGACTTGGTAcacgagtttcttcttcttcctgtcgtc
AGTGTCCCCGAATTTGACCATGGCCCAGCCGTTCATGATGGTGTGCGTGCTCTTTTCCATGTTGTTCGGTGGTTTCTTGATCGCCAAGGAGGGCATTCCG
GACTACCTCATCTGGATCTACTGGATGGATCCACTCGCGTGGGGGATTCGCGCGTTGAGCGTGAACGAGTATCTGGCGCCGAAGTTCGACGTGTGCGTGT
ATCAAGACATTGATTACTGCGAGAAGTTCAATCAAACGGTCGGAGAATACAGTCTGGGCGTCTTCGACCTGCCAACGGAGTCGATGTGGGTCTGGTACGG
GTGGATTTATTTGGCTGCAGGCTACTTCGCGTTGATTTTCACGTCGTACCTTGTGCTGGAGTACAAACGCTTCGAGAGTCCCGACAATGTCGCGGTGATC
GCGGATGGAGAACCCAGAGAGGATCAGGCCGTCTATTCGGAAATGCCAACTACGCCGAAGGTATCGAAGGAGTACGAGAGGGTCATTGAGATCCACAATG
TCGACGATATCATGGGTGGAGTCCCCACTATCAGCGTCCCAGTCGAGCCTAGTGGCCGCGGTATCTCGCTCCCGATCACATTGGCCTTTGAGAACCTTTG
GTACTCCGTCCCGATGCCTGGAGGTAAGAAAGACGAGGAAATCGACCTGCTCAAGGGCGTCTCCGGTTTCGCTCTGCCTGGTACGATGACTGCACTCATG
GGATCTTCTGGCA