Description :
From Genome Similarity Track
Location :
Scaffold_225:79803- 84852
Sequence
5049 bases(100 bases per row)
GTAGATCAAGTCGTTGATTATAAAAAGTCGACTTTGCGCTTTCGGTGTACGATGATGCGACTAACATGACCTCCTCATTCGCGACCGGGGAAGCAACGTA
CAGAAACAACAAGTCGAGCCCGGGCTCGTGTCAGCTCAATCGAGCGACTAATCTGAGCACTTACATATCAGAGCGATAGCTCAACATCATTATCTGGTAC
ATCAGTTCACAAATTTTCATGTCTTGCTTTACCTCGACCCTGTGGTTACATGGACTGAATCGTCATGGCTGTCGTGATACGACGTCGAAAGGATCGACTC
CCACTCAAACGTCGAACGATGCTCGTGACTATCCGTATCGTACACCTTATAACGGTGTCAGCGGAGCCATGCGTTCTCCGTCGATTTTGCTTGGAATGAG
ATGCCCGCAACTCCACGTAGGCTCCTCGAAAGCTCGAAGTTGTCCTCGTTAGCGTGAATAGCAGATGCTGCATTGGAGCTAATAGTCGTGGAAGCCACTG
GTTTAGCACACGTCAGACGACTGATTAAAGCCGCGAGCAAAAACCAGTATAGCAGACGCATAAGATTGGCTGGGTGCACGGTACGGACGGGTATGTGTCG
AGCACACTAAAAATAATCGACGCCACGTGGTCAGATGAGCAGGTCGTGCTGGGTGTGTACTGCCGTAGGAATACGTGCCGGGACATAGGAAAATTGAGAC
TGATGACGACTCAGTGCCTCATTGCACGCTCATCTCCCGCAGCATCCTGTTGGTGTCACTCTCATGATTGGCACTCGTAGTAGCCAGACAGCGATCTTGG
CTGCTCTTTTACAATTCCGTCGGAAAATTTAGGTCGTCAGCATTCTTGGGGTATCTACAAGCATACTCGAGAGCTGCAGAGCACATATGCGCACCTTTTT
GCAGTACTCATGAGCGACAGAGGACCACTTGCTAGATCTTTGTCATTACCTTAGGAGCCTATGCGCACCGTTTCCTCTCCACTTGGCAGCATAGCATAGC
GCGTTTTCTCGCATGATGACTACATAGTCTGCCGATTTGTGATGCTGGTTTGTTATAAGGAGGATGTGTTTACGGCATCATATCATTGTGAATTCCACCA
AGTCAAAACGTGCCGAACCGAGACCGATCCATACGTCGTCACAGTTGACGATTTGGAGACACAGAGTCCGGCTTCATATGGTACGAACCATGACTCCGGC
TCTTGGTATCGTAGCCTATATAGCATTTCACTTCATGTCTGAAGTGTCCCAAACCGATGGTAAAATGCGAAATCTTTGTACTGATCGGAGATTGCGCACC
CAGTTGTCGTACGGTATGCTATCTTGAGAAATGAGCAAGCTGTCGGGATTATCGGTCTTTGCAAGGTCATTATGCTGTAGGAGTAATCGAAGTGACAATA
CAGCCTGTCATTATATGATAGTGAAGTATCAAACCACTCTAACGTTGCAATGCTGATCAGTACTATGCCATGATAGATCCGTAGTTGTCCTTCGCATCTG
GCGCCTAAATCAGGGCGGCTTAGCACTACATAGCTGCTCAAGATACCAATAAACACTGGATGTAAGCTACTCCAAACGCGTCTGTGTGGAACGGCTTCTC
GTACGTATTGTATCTCCGATCGGCCTTCGGTCAATTGTTTGTGACCAAGAAGGGCTCAGGCAGAATCCTCTCAATGCAGCAGTGAATGGTCCAGCTACTG
CATCACCAGTTTAAGTTTTAAGCAACATTCAAAACACGTCAGCTTTCGCGCAGTACGATGCATCGGCGTCGAAATACGCAGCAACATTGATGTAGCGGCA
GATGCCCCATCAAGTCGTAAAGTCTGACTATGTTGTTGTTTGACCTTTTATCATCAAATCACTTAGCAGCGTTAGTAGATATAATATGAGCAAGCCACTC
ACACAACGGTCCGGGGCTACCAAGTCCACTGATTAACTATGAGGACTGATTCAGCCCCGTTCTGTTGCGTGGGGTGTCTGCAAATTAAGTAGAACTTGGG
CTAACCTCAGTCGTGATTAACGTCTGCAAGGGCAGTTTCCTCTCACGTATCGAATATGGTGACTCTCGAGACATCGAGCTTCGAAGTTAGTTGGAAGCAC
TGATTTACAGAGCCATGCAAAATCCAACCAATGCTGTGGACTGCCAGAAACTTTATCGTTGCTGCTTAAATTGTCGCCTACATCATTGCACTCTTACCCA
CTGATGTTGAAGAGAAGAGGTCGTCAATCGCTACCAGAGCTGCGACTCCCTGCTGCCACCTCTGTCCTGGTGAATCGACGAGTGTCTAATTTTTTTTTTA
GGTGCTGTGGGTACATTTCGTATTTCTAACGACCGACCTCTGCCCACTTCGGCGAAAAAAATATTATTTTCTTAAAAATCAAAAAACGATAAACTTATTA
ATATATTAATATTTTCGATAAAATTAATATTTGATAAAATTAAAAAAATATGATTAAAATTTAATGAACCTGTAAGAGCATAAATTATAGTGGGGCCTAC
ACATCTCCGACCGGATAGCCACTACTAACTGAAATCTCTGGGGGCCAGCCAGTCCAGGGCCCCCGACTATTCGATGTCGAGGGTTTATTCGTCTTCAAGA
GGCCGAGCTCAGTGGTACCGGGGTTCCCGGATGGTACAACTAAGACTTGTGTGTCACACATTTTTAACGACCTTGGGTTGGTCGCAAGGGGGATCAAACC
GGCAATCATTGGATTGGAATGGCGGTGCTTACCCAAGGCACCAGGGGGGAGCCCTCTCGACGAGTGTCTAATGGTCATCTATTGATCGTGGCACGTGGTC
CCGTTCATCATTGTAGCTGCTGCTACTGGCAGTTATGGCGCAGATGATTTCAGAGGCTTGTTTTCTACGCGAAGTAACGCTATCGGTAGATAGATACATG
GATGGTCCATCCACTGCGTTCGGGCGTAAATGGGTGAGCATTCAACCCCAGTCACTAGCGTCGGCGGATGCGTGGTCAATTTTTTGTGCATCCAGTTTGA
CAGAGAAGTTTCTAGCGGTCGAATCGCTGGCGCAAGGGTTTCACGTCCTACAATACCGATGCGACTTCCTTAGCGAAGCCCTAAATTGAAATGAGTGGAT
GTTGCCCCGATGACAATCTGATTGCAAACGTATGCAGACGAGCGTCACTGTGAGCACTTAGCACAGCAATGGCACTTTTACAGATATGACCATTTTGTGA
TGTCTTATCACATGACGGGCGTAAATGCGCTCCAAGCGCGGAGCGAGCATTCAGAACTCGCACGGGCTGCGGGAAATGAGACGCGGCGTGGATCGAGCCC
GAAATTTGCTTTTCAGCTCACTCAGCCTTGCTCGCAGTCGAACTCTTTAATTCGTCCGCATCCAAAGTTATTCGAAATTTTCATTCTAACCTTGGACGGC
TTAGCTGCTACTGAGCGCAGGGCACTCCTTCTTTTTTGGCGCGAATTATGTTGCATTCAGCTGGGATCAGGTGCGGGACCAAAGTAATCGAGACAAATTA
ATCGGTGCATGTGCACATTGGTTAAGTGCATAAAGCCTTAAGATCTCCAATGTCAACACACAGCCCGCTAAATTAATTGATCGAACGCTTTCTTAAAATG
CAACACGTCATATTACTTGATCGAACGCTTTTTGAGCAAAGTTATTGCTTCCACATTTACATGTAGCGAAACGTTTTTTCAGCCACCATCCTGTCATTAA
TCATCCACCACCAACTAATAATTAATATGGTTCTATATTATTTGGAAAACAGTTCATTTAAGAGGTCACACAAATATACATTATAAAAGCCATTGGACAG
ATCTTTCGCAATCCATTGAGTTAGATGCTATTAGTTCAGGCGTAAGACGTGCGACAGAGTCACACGTCTTACTAAATCTAATATCACGGAAAGCGAGATT
GTCTCGCTGATCGGGCATATAAACCAAATACAGATAGGCCGAATGTATTAGATTTATGGGCCGCCGCTATCTACAAAGGTAGACAAGTAGTCCTTACATG
CGATCAAGGGCATCGTGCTGGGGTGTGCTATTTAATGTCAAGGACTCGTCATCACAAGTTGGAAAATGAAGGTTGAAGTATCAGAAGTTTGTTCGATAAA
CTTATTATTTGTGATTGGCGCGACACTAGACGAAGAGGCCAAAGCTACCCTGGCCCTGAACAAGCACCCCGTACTACGGCTGAAACACGTTCGCAAATCA
TTTTTATATCTCTGGGGGTTAGACTAGGAGCGGGATATAAATAAATATTCACTGCGTCCTCATTTTTAATTGCTTACCCTTTTTTGCGTTTGGCAACAAC
GACACATCATTTTTGCTGCACCTGAGCTTCACTTGCTCTCTTCGCCTCTTTCAAAGAATCGTACACAATCTGGACCGTGACAAAAGACTCTCAATAGATC
TTAGCAATGGATTGACAAACCTGGAATTAATTATTGTTAGCAGCACAAAAATGGACAGAGGTTTAATAATAAAAATGTTTGAGCCTGAAAAACACTGGGA
AGCTTCAAATATACCTAGGCGCAGTGTTCGAAATACCCTAGGTTCATATCACGATATCCATTGTCGTATATTTTCTATACCAGCAAATATTAACGAGACA
GTCCTGACTTTGCTTTTTTTATTTCTTTATCCTCTTCATTACGATGCGTCTTCCAGCCTTCCCCTCAGGTGGTACCGCTCACGATACTGAGCCTTTGCTG
CTTCAGAGTCGGTCTCAGCTACTAATAAAGCTAAATTTTGGAAGCTACCTCGTAAACATATATATGAAGGAAGACCTTGACGCTCTCAGACCCTTTACGA
AATCACTAGCTTTATTACCAGATTTTTACTGATTTCTTGCTTTCTTATATGCTCATTTGGGCCTCAGCGGTCTTCATCAGTTTGTCATCAGCGCCTGCAA
GCAGTGTCTCCGCTAGCAACTACTAATGTTCACGCGCGTGTAGTTGAACAGATCTCTATCACCATCGCAAGCAAAAACAAATTTTGGCGTGGGGCACGCT
TCCTCACATGTACTCGGACAGCGCTGGTTGCATTCGAGCGATACATAAA