Description :
From Genome Similarity Track
Location :
Scaffold_523:7980- 12317
Transcript NameFunction/comments
g17625.t1hypothetical protein

Sequence
4337 bases(100 bases per row)
AGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGTAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCT
CGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGC
TTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCG
GGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGA
CGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGC
TTGCGAGCCGTAGCGGGCTTAGGGTTGTGGTACAAGTCAACATTAAAACGTATCGATATAAAATATAAGCCTTTCATAGTAAACAATAGTAGTGAAGCGA
GCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGT
CCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGC
GAAGGCGGCCTCCCCATTCGCTATTATTATAATACGAGGCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGA
CTACATCACATCGGAAGTAGCCGAATGAAATCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTTCCATTTTCAAAACGACG
CTCCGGCGACGGACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGCAGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAA
TTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGG
AGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATC
CCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTT
CACCCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTGCAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTT
CGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGC
CGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTAC
GGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAA
CCGTTGGTTTGGTGCAGTCTGCGCTCAAACTCGGGGTTTGTACGGCCCTTTAATGCCTATGATGCCTTGCTGCTAAAAAAAATATTAAAAAAGATTCCCA
AAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAG
GAAGCAACTAAAAGAAAAGAAAACAAAAAATTGAGGTACCGAGTCGCGCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCA
CCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGC
AGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGTGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGT
ACCGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGC
AGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTT
TGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCTAACGCGTCACCACAAGGATATGAGTCTCCAGCGTCTAAGAGG
CGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGG
ACGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAG
GGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGG
CGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAGCGAAACCGGATCGCACAGCAGGAACGTC
GGCATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACACGATTGCACTGAAGAACGGAT
GGTAAACCAAGAGCAACATGCCCAGCGCCGATCACAGCTTACGCAGGAGGAGCGTGCTGAAGCGCGAAGGGTAAACCAAGAGCAACACGCGGAGCGCAGA
TCACAGCTTACGCAGGAGGAACGCGCCGAAGAACGCATGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGC
AACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGT
TGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGAC
AAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTATCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTT
TTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAATCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCG
CATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGACCTAAATTCGCGCAGATCTATATTG
TGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCA
CAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATA
GCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATA
CTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTACCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTA
CACAGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAG
TCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGT