Description :
From Genome Similarity Track
Location :
Scaffold_87:7980- 9582
Sequence
1602 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAATGCTACATACTTTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGCTCTCATTTTAACCCAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCACGAGTATAACTAACTCTACGTTAA
ACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGGTAAAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGA
CTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGAATACGGAGGTGTCCATGGAGAGCTCCACTATGCCTGCAACTCACGT
TGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGT
ACGCTAACGCCGACAGAGCAACATGGTGTTGCTCTGGGGTTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTACCACGGTGGCGTCGGAGACGACGC
CGCGAGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATCGCGGC
TCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCTATGTCATGCCTTGGCGGACGAGCGAGAAGTTGAGCGTGTGGACGCCGACTCTCGGATCCT
ACATGCTTTAGCACGTACGAGAGTTTCAAGGAGGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAACGCGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGC
AGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCAC
GTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAA
TTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAACCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTG
CTGCAACTGCTGGACCCCAGCAGTCGCAGGGTAACAATGTGCGATGCTACCGTTGTGGTAGAGTCGGTTACTTTGCTCGGGAGTGCACGGCCCCCGTGCA
CCAGAAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCAGGGCGCCCTACTGGTAATGCAGTTC
CACGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGGAGCTCGACATCT
TG