Description :
From Genome Similarity Track
Location :
Scaffold_285:7980- 9532
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_285-snap-gene-0.16Jouberin (Abelson helper integration site 1 protein homolog)

Sequence
1552 bases(100 bases per row)
CGCTGTCGTCGTCTCTCCAGTGCGCGCTTCACACGCTCACTGTGGTCATCACCCACTGGACGAGTCCCGTCACCACCATCACTGCCAACTGCACCAGCAG
CTCGCTCTTGCGCGAGCTCTCTTGTGAACGCGCTCGACGAACTGGAGGAGGCTGCTGCTGCTCTGCTGAAGTCAGCGACCAGCAGATGCCGCGCGAGGTC
CTCGTCGGTTCGATGCGCACAGAGCAGCACGATCGGATGGTTCCCGCCTGAACCACCATTGTCAGGTCGTTAGTGTTAGTTTTTCATTGAAACCAAGCGC
CAAGATCTGCACCGAAGCCGAGACTCACCGTAGGAACAGAGCGCGACGATGTGTGCTGCCGGCGACCAGCTGATGTCCACGACAGGGTACTGGTGGAAGA
ACGGTTTTCCCCAGATGCCTCGCTGGAACTTCTGGCCCTGGACGCTCGCAAACAACAGAGGGACACCATTCTCCGACCCGCTCACAACGAACCGGCCATC
GGGGCTGAACGCGCTCTTGCCCATCGTCTTCTCACACACGACACCAGTGTAGTTCTTGTTGAGCAGCAGGTATGACCGCAGCTCGTACTGTAGAATGGCA
CTAGGCTGCGTATGCACGAGCAAGTGCTGCTTCCGCGGGTGCAGCTGCATGCTCGTGACGGCCGTCTGGCCTGTGTGGATAGTCTTGACAAGCTCATAAC
ATGGAATTGATAGTGAAGAAGACGAAGATAAGGTAGGCTTCCAGACTGTGAGAGTACCCTGCGCATCGCCACAGAAGAGCCGTCCAGACTTTGGTTCAAT
GCGAATACTATGCACCGCAGCTTGGCTGACTCGGAGTCGGCCAAGCTCACCGTCTTGTGACCCTGTAGGTGAGTTTGCCGTACGACTTTGGCTGGGAGTA
CGCCAGAACCGAACGAGGCCATTGGACGCCCCAGTGATGGCGAAATGCTGCTGAGCACTCACAGGATGGAAGATGCCGCAGTACACGAAACACGGTGATG
GCGAGTGCTGCCAGATCGAAGTACAACTGCCTGGCGACCCATTTGCCATCATCAGCCTCCACAATCGAGCTGTTCCATCTGAAGAGGCCGAAATGAGATA
CTGAGTGCTCTGGTCCCACTCCAAAGTGTAGATCATGGCGCGGTGGCCGCGACCTATTTGCACCACTTGGCTCGAGTTGACGTGGTAAACGTGCACGAGA
AAGTCACCCCCGCAGTCTGGATTGATCGCTGCCGCGAGGAACAACCCGCAGGGGCTGAATGCGATGCACGAGCAGCCCTTTTTGCCCGTTGACAGGCGAC
AGAGTACGCGATGCGGTACGAGACACGACTCGGTCGGACTGCGTTTGCACACAATGAGCGGGTCAATCGTGCTCATTTGCTGACTGTCTCTGTTTGTTAT
TTGAGATGGCGTAATGTTAGTGCTTGGACTGACTGGAGAGGTCTGCTGTAGCTCCTGGTTGGTGTCCACTTCAGACGGACCATTCTTGGTCTCGTCATCG
GGATCGTGATCGCCAACTGGCTCTGTGTTGTTGTCCTCCTGCGTGAAAGACT