Description :
From Genome Similarity Track
Location :
Scaffold_75:7980- 9250
Sequence
1270 bases(100 bases per row)
CGATGACGAGTTCTTTTGCGGGTTGGCGGGCCACGAGAGCGGGTATATCAAGCTCCCTAACAAGCGGGACGATCACTATTTCTACTGGTTTGTCGAGTCG
CGAAGCAACCCGAGGAAGGATCCGCTGGTGCTGTGGCTGACTGGCGGCCCCGGGTGCTCGAGCATGATGGCGCTGCTGGCGGAGAACGGTCCGTGCCACG
TCAAGCCCGACTTGTCGACCGAGATCAACGCCTACTCGTGGAACCGCGAGGCCAACGTCATTTGGCTGGATCAGCCGACCGGCGTGGGGTTTTCTTACGG
TCCCGCTGTTGACTATGACTCGGGTGAGCTCGACGTTGGCGAGAACATCTACTGGTTCCTGCAGGAGTTCCTCAAGCTTCACCCGGATCTCGCGGATCGT
GAGTTCTTCGTCACGGGCGAGAGCTACGGCGGCCATTATGTCCCGGCGGCCTCGAGTTACATCCTCAAGGCGAACACAAGGCGCCACCTGCTTCCGGGCA
CCGTGCATATCAACTTGGCGGGCATTGCGATCGGCAATGGGCTCACGGACCCGAGCATCCAGTACCTGCACAGCGTCGACATGGTCGACAACCCGTACAA
TGTGACGCTGCTGTCGGACGAGCAGATCAACGACATGCGCGAAGCGCAGCCCATCTGCCACGACCTCATCGTCGAGTGCGAGCGCGACCGCGCGCTGTGC
GAGGACGCGCTCGAATTCTGCCTCTCCAACCTCGAGCTCCCGTACTTCCAGTCGGGTCGCAACCCGTACGACATTCGCCAGCTGTGCGAGCAAGACGATG
TGATGAACTGCTTCGACTTTGAGCACATTGGCGAGTTCCTGAACTCCCCCAAGGTGCTTGCGGCGCTGAACGTTGACACGGAGCACTCCAAGCCGTGGCG
TGAGTGTGACGCGACCGTCGGCGCGGGGTTCGCGTTGGATGAGATGCTCTCGTTTGCCGACGACGTCAAGTTCACCCTTGAGGCTGGCGTTCGAGTGCTG
ATCTACGCTGGCGATGCCGATCTCATGTGTAACTGGAAGGGGAACCAGGCGTGGGTGCTGGGCCTCGACTGGAGCGGGAAGAAGGGGTTCAATGATGCGG
CGAACCGTCAGTTTAAGGCTGGCGATGTTGCCGATGCAGGCCGCGTCCGGTCGTTCGAGAACCTCGCCTTCGTCCGCGTGTTCAACTCGGGCCACATGGT
GCCGATGGACCAGCCGTCCGTCTCGTTCGCCATGATCAACAGCTTCTTCCACAACTCCGCCATCTAGGTG