Description :
From Genome Similarity Track
Location :
scaffold_1144:798- 6637
Transcript NameFunction/comments
g11061.t1hypothetical protein
g11062.t1 reverse transcriptase

Sequence
5839 bases(100 bases per row)
CTTATCGTCTTGATATTAGGCATGTCGTGGCTTGCACGGCATGACCCGGTGATCAACTGGGAGAAGCGTACGCTTGCACGCTTCAACAGCATGGGCGCGA
TAGAGAGCGATGTCCCTGTCTGTGCCGCGCATGCACCTGCCAGTGCATGCGACTCCCCAGCTTAGGCAGCAGCAGCCTCCGATCGCCGCCGGCGACCCTT
GACGACTCCGGGAGTCGTTGAAAGAAAATGTGTTTCGACTCAGATATCTGAGTCTGAGCCGAAGGGCCGCCTGAGTGATCACGTGAACAAGGGTCACATA
AGTGAAGGTCACCTGAATTAAGGTAACCTGAGTGAAGGTCAGGTATCGGTATCATTACCGATACCCATACCGGTATCGCTGAATGCGAATTTAGAACCGA
TACAAGAACCGGTATCACCGGTTTCCCTGGAGGTACTTCAAGCCTCCAAGGGTCGCGCCGACGACGTCGCGTCAGCTCCGGGAGCTGACGAAGCCAGTAG
AATTCCGGTTCAGGGAACCGATAGACGTGAGCCAGCACCGGGAGCTGACGCCACAGGCGCGGGTGTGTCGACTCAGGGAGTCGACGTCACAATCAAAGGG
CCACTAGTTCAGGGAACTAGTGAAGACACATCAGCTCCGGGAGCTGGTGATGCATTTGATCCATCAGCTCCGGGAGTTGATGGAGGCGCGTTAGTTCCGG
GAACTAACGACGCGGCAGGAGGTGCTGGCGGTTGCAAACGTCCAGCAACAGAACAACCTGCGTGCTCACGTGCAGCAGAGCTGCACGCGATGAGCGGCAC
ACAAACCGGGCTTGATTGTGCGAGTCAGCGGAAGACATCCGCTGACGACTATTGTGATAACGACCCGTCCAAGGCGAAGGCCCTTGGACACGGAGCACCT
GGAGCCGGGCTCCAGGGAAGAACTTCACGGCGCAAGCCACAGAAGCTGCGCGAGGCTCAGTCCGGGACTGAGACGGGTGTATCTGCCGAGCAGACACCGA
GTGTCGAGACGTTGAACGTCTTGACACGTACTGGTACTGGATTCCAGTACCAGAAGATGCGGTTAGAGAATCCGCCGACGTGTGCGTCGGCGTTGACCGC
ACTTCCGACTATGAGTTGGAAGCGCTTCGCGCGGGACTTGTACGATGGACGCATCGAACAAATTTGCATCCTCTCAGATGTTGAGAGGGTGGAACGCGAG
GCCGAAGAGCTGAAGCAGCTCGTCGTCGATGGGATCGCTGAGGGCGATGACCCCCTCAGTGTGAATACCAAGAAGCAGCGCTTCGAGGAGCAGCGTTGGG
ACTCGTTGAGATCGAGTCCCTACTACGACATTCTGCGGGAGTACAAGAATGTACCCCCTGACGAGATTCCTTCGGAGCTTCCGAAGGATAAGGGCGTACA
GCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGTGGGAGCAAGTGCAAGTGATCGACGACTTCTTTGAAAGT
CGTCGTCTTGCAGGTCAAGTGCGGGAATCAAAGTCCCCGCACAGTGCCCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGAGCATCGTTCATGCGT
ACAACAAGTTGAACGATGCGACGATACCGGCGCAGACGCCGATACCGCGAAAAGATGTGATCATCGATTCGATGGCCTTGAGCACTATCTTTAGTGCTCT
AGATCTACGTGATGGATTCTATCAAATCCTCATGCGTGAGAGGGATATACCTCTCACAGCGGTAAGCACTCCAAGCGGAATGCTTTGGGAGTGGCTCGTC
ATGCCGCAGGGACTTAAGAATTCCCCTGCGACGTTCAATAGATGCGTGACATATCTATTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGACG
TGTTCGTCCACAGCTGGGCTGTGAATGGTAAGACGGACGTTGAGATGCACAGGGAGCACCTCCGGAAGCTGCTAGAGCTTATGAGGAAGCATAAGCTCTA
CGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTGGGGTGTCTCGTCGGGAAGGACGGCGTACGCCCTGACCCAGAGAAGGTCAGA
GTGATCAATGAATGGCCCGCGCCATCCAATGTGAAGGAACTGAGGCAGTTCCTTGGGCTCGCCACGTACTTGTGCAAGTACGTGGAGAACTACGCGGGCA
AGATTCGCCCGCTGTCACAGCTTCTTAAGAAATAAGCTGAGTGGATTGGACCACCGAGTGCCAAAGGGCATTCGATGCGGTCAAGCAGTGCTTGACTGAG
GCGCCGATCTTGGCAGTGGCTGACCAAGATCGTCCATTCCACGTAGTGTGTGACGCATCCAACTTTGCAATCGGATGCGCATTGATGCAGCACGATCACG
AGGGGCGTCTACTATCAATCGCGTCAGCTGAAGCCAGTTGAGCGTAACTATCCCGTACATGACAAGGAGCTCCTTGCCATGAAGTATGCACTCGCAAAGT
TTCGAGTGTATCTACTTGGGAGTAGACCGTTCGTGGTCTATACAGACCACGCATCACTGTGGACGGCTATTAAGTCGCCGCACATCTCGCAACGTATGGC
GAGATGGTTGTCCTTCTTCGCGGAGTACAACTTCCGGGTCGAGTACAAACCCGGAAGACTCAACGTAGTGGCCGACGCGTTATCGCGTCGACCTGACTAT
GCGGAGACGGTCGACGTCAACGCTGTTGGCGTCGTGAGGACAAGTGTGCCATCGTCAACGTTGATTGACGACGTGAAGGGCGCGTATGCAAGAGATGCAG
ACGTGAAGGGGCTGCTGGAGTACCTCGCAGCACCTTCCGACGTGGCGCGTCGGAAGCTAACCCCTATCTTCGGTCTCGTGTACATCGGTATCGTGTACAC
GAAGGGCTACTGCTGTACAGTGCAGTAGACGACAACGCGGACCGCATTGTCGTCCCAAATGATCATGATCTGCGATTGAGGATCCTGTTCGAGTATCACG
ATGCCCCTACGGCAGGCATCCGGGTCGTGAGAAGACATACACTCTTCTCACGCGTGACTTCTACTGGCATCACCAGTACAAGTGGGTGCGCAAGTACGTC
CGTGCTTGCGAGGTTTGTCAACGCGTGAAGCCTGCGCCGTTCTCGCAGGCTCCTCTTCAGTCACTTCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCCT
TGGACTTTGTCTTCGGTCTTCCGCCTGACAGCAAGCGGAGGACGGGCATCGTTGTCTTTGTGGACCGATTCAGCAAGACGGTCCATCTTGCTGCCGTCCC
GGCTACTGTTACAGCCGCGCAGACTGCGTGACTGTTTGTTGTCATGGTGTTCAAACACCATGGCATGCCGCTCGACATTGTGTCGGACCGTGATCCACGC
TTCACAGCGCGGCTCAGGCAGGAAGTGTTTACACTTCTTGGTTCACAGTTGTCAATGTCGACTGAGGATCATCCGCAGACGGACGGACAGACCGAACGCA
TCAACCGTGTGCTGGGTGACGCGCTGAAGAGCTACGCTCACTCGTTCCAGCATTGGAGCGAGTGCTTGCCGATGGCAGAGTTTGCCATCAACAACTCGGT
GCATGCCTCGACTGGACATACACCGTTCTACGTGAACGCCACGAGGCATCCACGTTTGCCGAGCATGGTCGGCGGGGTAGCTTCCTCCTTAAATGGGGGA
GGATCTACGGTTGCGTCTGAACAACCGCAGAATACAGCTGATAGCACACTATCAGCTGCGGTGACGCGTGCAGCGTCTCGTTCGAGTAGGAACAGACGCT
CGATGTCTGTGCTGGGCACAGACATAGGGAGTGATAGCGCGCAGGCAGGGCCTGCTGCGGACGAAGACGACGAGCTGAAAGGATTCAGCTCGAGCGCGCT
AGACTTTGTCCAGCGAAGACAAGCCGCGATACGGTTTGTGGAAGACGCTATCGCAGCTTCTGTCGATCGACAGAAGCTGAACGCTGATAATGTTGGCAGG
GGCAACATGAATGAATTCAAAAAGGGTTCATTGGTTTTGTTAGCTACTCAAAACCTGCCTAAACATGCAGTGTCTGGCTTTGGAGCAAGTAAGCTTGCTC
CAAGATTCATTGGGCCGTTCACAGTACTTGAACGGCACGGCAACGCGTACCGGCTGGACATACCGTCCAGCATGAGGCTCCATCCGACGTTCTACGTCGA
GCGGTTGAAGCCGTACGTGCAGCACCAGTCATCTAGGGTTAATGACTCGCCTGGGAGGCCTGGAAGGCCTCCTCGAGCTCGCGGAGACGCTCGACATACC
AGTTCAGCCTCGACCCGAGACTGGACGAGAGGTTTGAGGCAGTCTGAGCCGCCTCAGCGGCGTCAGCACGAACGTTCCTCACCTCTTGACGCAGAGACGC
TATCTCAGCGCTCCGGGAGTGCTCAAGAGCAGCAACCCGATCGTGATGGTCATAGCGTTGACCATACGCAGGGAGTGTTCCCACCCCCTCCGCCGCCGTT
GCGCGACGCGAGAGGAGCGATCCGCTGGATAGTTGAGTGGATCGTGGATTATACGATGACGACCCATCAAATTCATCGTTTTCGAGTTCGCTGGAGAGGA
TTTCCTCCCCATCGAGATTCATGGGAACCACGGAACGCCCTAATGGAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGTCCGCCATAACTTGCAGGGTT
AAGCCCTGCACGAGGAGTGCTGCGGTCAGCCACAACACTCAAAGCCTTGCGTGGCTCAATACGAGTACGGAGCTCCTTGATGTGATCGGGTACACGCACC
GACGTGTACCCAGTAAGGTCACTTTCGGAGAGGCGTGCTGCCATCTGTAGGCAGCACGGGTAGCTCGTGCTAACAGGTACGGCGCAGGGAATTCCCGCTT
CCATGCATAGACCATGGAGGCGTTCACACCTACTGCGAACGGTGTAAGTGTAGTAGCGTTCGCGAGCATTGTCAACGCGCTCGCGATAGGCTTTCGGAGC
CTTGTTGAAGTTTTCAACAAAGGCGTTCCACGACTGACAAACCCGGTTTTTTTGCCGTCCAGAAGTCAGTGACCATCGTCATACTCTTCACACCACGGAG
CCGGTTGTCAAAGATATAGCGAACTAGAGCGAGTTTTGCCGACACATAGAGCTCGATGACGGAGTGGGTAATTGTCCGCCGGTTGATCACGGTCTGGAAA
TTCTCTTTCGTGACAACAGCACGCAAAACTTGAGATTCTTCCCACTCGCCCATGATAAACGGTAAATTGTTGTGCACCACAAGTAAAGTTTGAAGTAGCA
AGCTGATGCGTTCACAGCTTTCTTGGGTTTGTGCAGAGGCTCTAATACGTGCCACCACCTCATCTCGGCTCCGTTTGCGGAAATCTTCCAGTGTTGACTT
GGTTGAAGTGACGTGATGCGAGTCCTTTAAATGTTTTGTTGCCCTGGATGTCTTTCCGCCGTACAAAACGTGCACGCTCTCGTTTGAACGACAGTGCTCA
CTTGCCAAGCACACTCACCCACATACAGTGGGGTCACTTTGATGGCGAATACGAACCCCCCCCCCATTTGTAAATGAATGATCGTTCGGTAGGTCTTTGA
ACAATTAGCTCGAATCCAGCTTTTGGGTGGTAATTTTGGACTGCAAATTCAACTTCAGCTGGAATTCCAGTCGGGTCAGGGTTGCTACGTACGGCAGCGT
AGCCATCACAGATTCCGCTCCGCCGGAGCTGCGTCTGTGCGCATTTACCCGCGCACCATGCGGCTCTCTTTTACTTGAGACTGAATTATTCGAAACTTCA
CTCGGTGGCGTTGCGCGTTCTTCTTGATAGGTTGGTATA