Description :
From Genome Similarity Track
Location :
scaffold_59:79792- 81932
Transcript NameFunction/comments
Plaha_PHALS_01385conserved hypothetical protein

Sequence
2140 bases(100 bases per row)
TGATTGAGTCCCATGCTGCAAAGGAGAAAAGCGTGGAAACTTTGCGCAGAGCTAGTGATTGATCAAAAAAGAAAACGGTGGGATCGAAGGATATGGATTG
GGAAGACAGAAAGCGTCACAAAGAGGATTGAGCTGTTTCCAGTATCACAAACGTTCTTTTCAGCAGTAGCGGTCCTGGGTCTATTATTCCCGGATATGTT
AGCATTATGCAGTGCAAAGCCAACATTATCAGAAAAACATTGAAACAGCAAATCGATGTAGCGCATGCAGTCTGCATTTTCTCTAAGTTGTTCGAATTAG
CAGAAATAGCTGCTTGTACTATTAATGTCGTCATCTACCAATACATCGCTACATTCAAGATCCGTAAGCTTTACGTTTATCCCGTCTACCCAATATTGAT
GCTGCTGCTCACAAATGTCAGCTGGAGCTGTTTGTGAATGCTGCAAGCCCCACATCTCGCAACAGTTTTCTTGCAGCTGCATGTCCGATTTCCAGTCAAT
TTTGTCCACAGCCGGTACGACATCATGAAGCCCAAGATGCTTCAGCGAATCGTCATTCCATTTATTGCTTATCGTGGTCATTTTTCCAAGGGGAGAGAAA
AACTTTTGGGTAAGGCATGATGGCTGTTTTGCTGGTCGGAGTATAACACGAAGACTGGGTGGCAACTGCGGGTCCGGAACATCTCGTAAGCCCGCTGAAT
TGCTGTTCGCGGACGGCTGCATAATTCTGCTGGCGTCAGACTCGTTCACAGAAATTGGTGAGAATACTGTCGAGCTAGCCAGAGCTAGGTCGTCATGCAG
GCTTTGCCAGTATTCCAATGAAGGAGAAGGCCAGTTATTTCTAAGACTTTTCGCATTTGGGCTTTCGAGTTCGCCGAAGCATGCCGTGACGTCACTAGAT
GTCAAGCTGCTTACACTTTTGGATTTCCAGTACTTCAATGAGTCGATAGTAGCAAACAGCACCCTCGGATTCGTAAAAATTTCGTAGTTAAAGCGAACGT
ATTTGCGTAAACCTTTGTCGATAGACTCTGAACAAGGCACGGGCGAAGTGTCTATTATGTTGCAGCTCACCAGCACAGACACCACATCGTACACGCGGCG
GTGTACATCACGATAGGGTGCCTCCGTCGATGCGCTCGGTATCAAGCTACCAATAAACGTCTTTGCATCAACGAGACGAGCACTTATGGCAGGTAACCCT
ACTCCTGTTTTATAGTCTTGCTGAAATAGCAAGCCCAGGAAGCAAACTGTCATTGTTACCAGGCACGGCCacttgtcagcagctgcctGCTTTTCGAAGA
CACTTACGAGAGCGCTGTCTTTTTCCACAATGCTGCAACAATGCAGATGACGTGTCTGTCGGAATTCCGCCATCACCTGAGACGACCTGCTCTTCATTTC
TGCCAAATGCTGCACAACCGACGACTTCCCATAGTACAAGAAGTAGCCTCCGTTAGTCCCCCGCCTCTCGTCGTATCGAACTCGTTTGATGACACTAATT
CCTGCAGTTGCACATGTTGTCATATGTTCCCCATTTCAGCACCAACAAAGTTTTTTCAGTACCTTCCAGTACGTGAAGTACGTCATAAATACGTCTTTTT
CTTGGCACTAAGCAAAAAATGTCACTCGACGCCGCTGGTAGCAGGATGAAAAAGGCATTGCGTACCCTTCATTTTATAAATTTCGCTGGACGGTACAAAG
ATGGGAAATATTACATCAGAGGATGAGCCTTGCAAATGCTCATGCTCTGTGAAAAAGTGTAACACAATTCGCGTTCTGGAAGGCAACATTGATCCAGGTC
AGCACCAATCTGTGGCTTGGCGAATTTAGCAAACGTACATTTCCCCCAGACTCTTAGCTGCCGCAAATTGGTCTTGTATTTGGCTCCAGATGGTTGCTGA
CAGACCTTTTCCATTGATAGTGGATGTTGGACTGACATGACGCGAGCGTGACTGGCGTTTGCGTCGCTTTAGAGGTCGCTGTGGAACATGATTCACTTTG
ACAGTTACCAGTGAAGCAAAGTCTTTCGCGGAGAAGTGAAGCTTGCGTTTGTGAGCGCGGTGGGTCTTCATCTGTTTGTGTTTGAATAGGCAAAATTAAA
AGTGACCAAGATGTCTGCACTTGAAGTGACCTTCACTCTG