Description :
From Genome Similarity Track
Location :
contig_13:797802- 801396
Transcript NameFunction/comments
g2507.t1hypothetical protein
g2508.t1dead deah box rna

Sequence
3594 bases(100 bases per row)
CTCTCTTCTCCCAAGAATCTCAAGTATGTCTGGACGTGGTTTCGGTCGTGGTGGTGCTCGCGGTGGCCGTGGCGGTGGTCGCGGCGGTGGTCGTGGATTC
GGCGGCGGTCGCGGTGGTGGTCGTGGCGGCGGTCGTGGCGCTCCTGGTGGCCGCGGCGGCTTTGGTGGCCGTGGCGGTCGTGGCGGTGACCGCGGTGGCC
GTGGCGCTGGCCGTGGCCGTGGAGGTGGTGGTCGCGGCGGTGGCCGTGGCGGCATGGCCGGCGGCGCCAAGGTGGTTGTGGAGCCTCACCGTCACGCCGG
CATCTTCATTGCTCGCGGCAAGGAAGACGCTCTCGTGACGCTCAACTCGACGCCCGGCAAGTCCGTGTACGGCGAGAAGCGCATCTCGGTGGACGTGCCA
GCCGCCTCGGGCGAGGGTACCGAGAAGGTCGAGTACCGTGTGTGGAACCCGTTCCGTTCGAAGATCGCCGCCGCCATTCTGGGCGGTGTGGACAACATCT
GGATCCAGCCTGGCGCCAAGGTGCTGTACCTCGGTGGTGCCTCTGGCACGACCGTGTCGCATGTGTCCGACATTGTGGGACCCACTGGCGCCGTGTACGC
CGTCGAGTTCTCTCACCGTGTGGGCCGCGACCTCATTAACATGGCCAAGTCGCGCACCAACGTGGTGCCCATTATCGAGGATGCGCGTCACCCGCTCAAG
TATCGTATGCTCGTCCCCATGGTCGACGTTGTGTTCGCCGATGTTGCCCAGCCTGACCAGGCTCGTATCGTGGCCATCAACGCCTCGCACTACCTCAAGA
ACGGCGGTCACTTCGTGATCTCCATCAAGGCTAGCTGCATCGACTCGACGGCCCCGCCTGAGGCTGTCTTCGCACGTGAGGTCAAGAAGCTGCAGCAGGA
GCAGTTCAAGCCGGCAGAGCAGCTGACGCTGGAGCCGTACGAGCGTGATCACGCCGTGGTTGTGGGCTCGTACCGTGCCCCCAAGAAGGAGAAGAAGTAG
CTTCGCTCAGGAACAAGCCTCATGGTTTACACTCTCTAACTATGCAAACTGTTTTTCTACATGCTTTTGTCTTGTAGGTCTCCGCCTGGACATGTGAAGC
CCTCCTCTTCTTTTCGAGTCTCCTACCACGATTCCAAGCTGCGCTCTTCCTCGAGAGATGTCGTCGTGGGATACCATTGATCTGAGTGCGTTTTGCATTT
TTGCATATGAGTGGGGCGATTCCAACGAGGCCTGTTGCAAGGCGGCCTCCGACTTTCTCGATGATTAGAAGTATTGCGTCGGGCGGACTGAACAAAACGG
GGCTTGTTGCCGTTCCTCACCCGCTGAAAAGTGGTCACTGGGGTCGGCGGTGGGTCCTATCCGTGATCGAAAGACGTCATCAAAACCTCCAAGTGGGGTC
GATGAGAGAAAAGAAGGGCAAATGTTTGTATATCTGCATGTGTAGTCTTAGCTAGTAGTCCTGAGGAAGAGTGCAGCGAGAAGAGGGGTGGCCAACACAC
CAAGGGTGGAGACCTGTCCGTCTTTCTTCCTGATCAGTTCGCACTGGCGTCTACTAACATGTCGTACATGCAGCCTAAACAAGCAATACACGATAGTTTC
ACCGGACTTCCTCTTCATCTATTGTTGGTGCCCTGTCGGAACCAAAGTCGCAGGGTTGCATTTGAGCTCGTTTTACCTTCCTCCTAGCCCGCTATGCACC
GAGTCAGCGACCAGCTTCGAGACCGCCACCCGTACGCGGACCAACCTTTTGAGGAGTCCTTCAACCCGAAGGAGGTGGGTAGTCGGAGATAGTAAAATGC
TCTTCGAGAGACATGTGTTGGCTCAGTCGCTCATGTACTCAGGTGACGCGTGCGTTCGGCGCTAGAGCAATTCCGAAATATGCCGAGTTGCTGGCGACGG
AAGATCTCCCCGACGAAGACCGCTGCCGAGCACTTTATGACTTGCGCGAGCTGCTTAGCAGTCCAAACTTCAAGTACACGGCTGTGATGCGGGAGCTCAT
GTTCACGTGTGCAGACCTAACGCAGTCGATCTCTCCTGAGGTTCGCGCGGACGCTGCGCTGGTGGTTGCATCACTGGTACTGTTCGAAATGGTAAGCTTG
CGTTGCATTTTTCATTCGTGGCAAAACCACACATGGAGTAGTCACTGAGCTGTTGCCACACGAGCAGGACGCGCCAAACGACTTGAGCGACGAAGTTGTG
CTGACCACGGCGACTCGATTGCTAAGCGATGACGAAGAAGCGGTTGTCGCTGCTGGATGCCGCATTTTCATCAACTTGACGGTTTCTAACGAAGGGTGTC
TCCTGCTCGCCAACAAAATTGAGGCCGTCGCCACTTTAGCAAAGATGCTATCTAGCCAGCCGCTGTCGAAGCTCCCACCACAAATTGTCGAGTTGCTCGT
GGAGGTGCTGGCCAAACTCACACGGGTCTACGAGGGTGCTCGTACCTGCGCACAATTCACCATTGTAGCGCCGGTGCTGTCGCTGCTTAAAAAACCGCGG
CTGTGCCGAGCTGATACGCTATTGCACTCGGCGATGGTGATCACGAATGTGGCTGCATACGACCAAGCCAAGCGAGAAGCCATTCAGCTCAACGCCGTGG
AGTTGTGCCTCAAAGCGCTCTCGAAGGTCCTTCTAGGACAAGTGCGTTGTGAGCCGGCTGAAAAGCGAGATGAGCTCACTCGATGCCTCACTGCAGCGGT
GATGGCGTTGTCAACATCCGAGGACGCCAAACCACGCGTGATTGAATTCGGTATCGAGCCGTTGGTACAGTGCTTGGCTCACACGAGCGCATCTGTGCGA
CAGAATGCCAGCATTACCATCAACTCGGCTTGTGATCTGCCTCGTGGCGTAGTTCCGTTCACCCAAAGACTTCTCCACGCACCAGACCTGTTGGTTGATG
TTATGGGCATCAAGTCCGTGTCGGCTCTGAACAAGAGCGTGAATAGCTTCAATGACGAGGATACGCCTGCCGCACTAATGGCGTTAGCTGCACTGCAGAA
GAAAGACGTGTTTGGAACTGCAGACCGCGTGGTTCAGACCCTGGGCATGCTGGACAATCTCGTCAAGCTCCTCAACGAAAGCGAGGTGCCCGCCGAAACC
CAGCTTGGTGTCGCCGATGTACTGAGACGAATGGGCCAGACCGACTCCAGCTATCGACGGCGCGTGGGCAAGTGCATGATAAAGCACAGTGTCTCCGTAT
CGCAGTTCGTGCAGATCGTAGGCCTTCCCCCGGCAGCATTTCTCGAGCAAGTTGCGTAGCCAGCAGCTTTACTTTGGGACGTGCTTTTTTTTTCATTGCA
CTTGGATACACTTATGATATGTATTCAGAGAGGGTATATATTGATAGAGGTGAAGAATAGCGACGGCAGGACGTCCTTATAAAAAACAAGATGTCGTGTC
CAAGGTGGTTTTGGAGGTGGCGACCAAGCCAAGCACTAATACACATTGCGATTGCAAATCTGCTCTTGTGTTCGTTGAGCCGAGAGAAGGTTAGCATCTC
CCTCGACAAGGACGGGATTGCGCGTATGCGTATCCAACCACTGGATGGTTTAAGCTCTGTCCTCCTTCGTGAAGACATCTACCAGTTTTTTTCT