Description :
From Genome Similarity Track
Location :
Scaffold_575:7978- 11862
Sequence
3884 bases(100 bases per row)
TCAATCTTTTGTGAACCCATGCAACTCCGTGTCGAGAATCCCCATCAAGACCGTCTTCATCTGCGCCTTCGACTCATAAAGTGGGACGTCCAACTGATTA
AAGCACGCGCGACTCGCAATGTACGCGTTCGAATCCGTAAACTTGATTCCTTTCAGCGTGAACGGACAGAGTCGACCGTCGCTACTCGTCAACGCACGGA
AGCCGCCTAATGGCACACGCGACGATCCCGTGGCGAAATTTAGCAGTCGACGACGATACTCGTTGGGCATCTCGCACACGAACTCCCAGAACCACGTGAT
GGCCTTGCCATGCTTCCGGAGACTTGCACTCACTCGTGTGCACCGCTCCCACTCATCGACGTCAATGACATCAGACCCACAGAGCACGAAATCTAACTCT
TCTGGGTCGAACACAGCGAGCAAGTGGAACGGCACGACTTCGTACAGACCTTTCAAGAAGCAATAAAGCTGACTGGACACGCTCTCGAACAGCAAGTACC
GGAACCTGCGTTCTAGGTACAGATCCTTGTTCTCGTCATTAACTTCGATATTGCGCCCGCCTTCGATCAAGTCGATCACGACTATTTCGTTGTCGCTGCC
TCGTGCTTCAGCGACACTGAAATCGATGCCTAGGTCGCAGACTCCAGTGTTGTCTCGAATCCAGAGCAGGCTTTTGTACACTTCGGGGTCGAAGAACTCT
AGATCGAGAAACGAGACGGGCATGCCGAGGATGATCTTCAACAGCGGCAGTGCTAAATGGAACCCGAGCACTTGGCCCTCCAGGAGTGCGCGTCCGACCA
ACCGCCCCGTTGCATAGTAATACAGGAGGTGCGCCTCGCCAATATCGTCGCGCGAGCGTGGGCTCAAGTAGAACACTTGCTCTGGTGCGTTGACACAGCA
AAAGACGCCATTGGAGGGGTTGGCCAGCGCCTCGTTGAGAAGCAGGAACCACTCGCGCTGAAGTCCACCGGCGTCGATGCCTTTCTCATCGCTAAAATTA
ACGCGCATCGCGGAGTGAATATGGTCCTGCGGAATCACACTCAGTGCTTCCAAGGAGTCCTCCAGCAGCTTGTCACGGCGAACGTTGAGCTTGACGTACT
CTTTCGTGACATCGACGATCAACTTCGTGGTGTTGCTCACAAAAAACGCATACTTGCTGGGAAAATCTTGTGCCGAAGCCGACAGGATCTGCTTCCACGG
TGTCGCAGCGGGAGCGTTTAAAACGTGAACAGGCTTCCGTGACGCTCTCGCAACGGATGACTCTGTGAGCACAGGCACCTGGAACATAACCTCCAACTGG
AGACTCTGAACGACGTCATCCTTTGCGAGAGTTGATGGCAAAAGACTGGAGTCTTCGGATGCAGCGTCCAGAGGTATAGTACTTGCGGGTTCCGGAGGTA
CCGAGGCATCAGAGTTGCTTGGCGACGTGTCCGGGGGGAAAATCTCGATGACCACTTTGGTTAGAGATGCGTCCTGATTGTCAATTAGCGGGTAGCGTGA
ACTCGTTCCAGAGACCACCGTCAACTTAGGCTCCTGTTTGGTCCCCGAATCTTCGCTCACCTTGGCGTCGTCCAAAAAAGCTAACGTGTATCCTGGCGAC
CGACGCATCGCCGATCTCAGAGTTCGCCCTCGACTCTGGCGGTACCAAAACAATCGGCCCTGGATGTCAACCTTGCGAGCCCATTCCTTTCGGGACCTAG
TAGACGGATGCAGTGGAGACGGACAGTAACCAGGTCAAGCGACAGCACACTTCGTTACTATCAGCTGGCGATTCACCTACCTCGCTCGCTTTTGACGGTG
GGATAAGTTCAATCGCTCGCTTTCGGTTGGCATAGCCATCGCGACATCACCATTATTGTCATTGGCAGCGAGTTTTTCGCCGCAGAGACTGCAAAACGGG
ATGCGCTTAAAGTTTTCAAAATTGCAAATGCGGCACGTGTTGAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCATCCCTGCGCAGGAGTCATATTG
GGGGGACCGCAGTGCACAGCACGTCAGTCACACGATATCACGCACGAATCCAAGCGAACTCGGTGTCTATTGACCTATGTATTGCATCACTAACCTGGAC
GCGGCTTCTAGACGATGGTGCAGGAGCTGCCCACTAGAAGCACGTACCACAAGGACATAAATTAACTTCCGTATCATAAAACGAGTGCGACAGCGTAACA
TACTGTACACACTTGTGCATTAAGGGCGCGTGCAGCTCGTCCTGCGTACGACGCGCGACCTCATTGTCGTACGCTTGGACACAGAGTGTGACGACGACCA
CGAGTGTCAGGAGGCCACAAATGACTTCGACCGCCACGCCGGCCATTTTAAAATGAACGTCGCACTTGGGTTGGTTTGCAGCGCAGTGCATTGGAGATGT
GGATTATGGGTACGCACAATCCACGTCTCCGTGTGCTGCAGACCTCCTGCCACCCAAAATACGTGTAACATCAGATATTAATTATGTTAGGAAACTGAGC
TTACTGCCAATTATGTGTTAGCATGGCAATGATCTTATCTTTACTAAAGTATTGGTTTGGAGAGTGAACACGGTTTTTGTCCAAATTGAAAAATAAAATA
ATGGACTCTCAAAGAGCACAGTATACAAAAGTGATAGTCTTGAGTTCAAAGTGGACTGCACGCCATCAATATTGTCATCTACCCGGACTCGGTTCAGTCG
GTGGTAAAGCCATTCGTCTCCGTGCTCAGTGTCGCGTACAACACGGTCCCGAGCTTCTCACGGGACGAAAACACGGGCAGATCCAATCGGTTGAAGCACG
CGTGGCTCCAGATGTGCCCATTTATCGTGTTCCCAGAGGTTGTTGCGCCTTCAGAGCCCTTCAGAGTGAACGGACACAGTCGGCCATCATTGCTGGTTAG
TGCGCTAAATCCCGCGATCGGGACACGCGAAGAGCCCGTGGCGAAGAGCAACAGCCGACGGCGATACTCGTTGGGCATCTCGCGCACAATCTCCCAGAAC
CACTTGACGATATACTTGCGATGACTTTGGAGGTTGTCGGCAACCTGGGTATGGCGCTCCCAATCGTCCACGTCGATCTCTTCCGAGCCGCACAGCACGT
AATCAAGCTCTTCGGGGTCAAACAGCATGAGTAGTTCTTGCGGCACCACTTCGTACAACCCTTTCAAGAACACATACAGTTGCGGCGCTACGCTTTCAAA
GAGCAGGTACCGTAACTTACACTCCAAATACTCGTGTTTGTTCTCGTCCGTCACCTCGATTTGCTGCCCATTGGGGACAAGATCCACAGTAGCGAAAATT
CCGCCACTGTTCATTTCCGTCACACTGAAATCAAGTCCAAGGTTCCTGATACCATCATTCTCGCGAATCCACAGCATACTTTTGTATGCTGCTGGGTCGA
AATACGCCAAGTCACTGAACGCGATCGGTAAGCCCAAGATGATCTTGAGAAGTGGGAGAGCCAAGTGGAAACCTAATACTTGACCTTCTAGCAACGCTCG
TCCTACAAGACGTCCCGTCGCAAAGTAGTACATAAGGTGGTCCTCACCAATGTCTGCCGCGGAGCTTGGGTTCAGGTAAAATGTCTGGTCGACTGGGTTG
ACGCAGCGAAAGATACCGGCCTCTGGCTCGGCCAATTTGTCGTTGAGCAGCATAAACCACTCGCGTTGGATGCCTCCGGCGTCCAGTCCAGGCTCGTCGA
GGAAGTGGATGCGCATTGACGAACGGATGCTCTCTAAGGGAATCACACTGAGAGACTCCATCGAGTCGAATAGCAGTTCGCTTCGATTGACTTTGAGCTT
CAAGATGTGGTGACGACCAGGCTGCATCAATGTCGTTGTTAAGGCAACAAACTCGGCGTACTTGGTAGGAAAATCCCACGCCGC