Description :
From Genome Similarity Track
Location :
Scaffold_363:7976- 13224
Transcript NameFunction/comments
Physo_144980hypothetical protein
Physo_144981hypothetical protein

Sequence
5248 bases(100 bases per row)
GGGACTACGCCGTCCTGGAGGACCGAGTGGCCGACTTCCGCGCTCGTGCTGAGCGCGCCGACGCTGCCGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGCACTCACCTCCACGCTTGCGCTCGCGTTCT
CGCTCGCCCTCCTTGGCATCGACGCGTTCAGCCGGCTCAACGCGTTCGGCGCACGCCGCGGGGTCGGCGCACTCGGCGGGGTCGGCGACCTCGCGTCACG
CTTCTCCTGCACGGCCGACGCACTCCTCGTCGAGGGGCCGTGCGGCAGCCGGAGCTGGACCAGGCACCGGTCCGGGCGATTCGGGCTACTCCAGTGGCAA
CGCCTCGTCCGCTTTCTCGTCGCCCCGCGCCTCGTCCTCGAGCACCGCCTCCAGCGGCTCGGCGGGGAGTGCTCCGGCGGCGCCCTTCTTCGACCCTGTG
ATTCCGCCTGCCGGAACTCCGTCTGGCTGGCGGCAGCCTCGCTACGCTCCTTGGCCCAAGCGGGTACGACGTCTCCACCTTCATCTCATCACCGTGCAGG
AGTTGCGAACGCTCTTCCTGCCGCCGCCCGGCTGGATCATTCGGCGCCGTGTTCCCCCCGCGCCTGCGAACTGGAACCGCGCCCTCGTGACTCTGGCCAA
CGTGGACGCGCTATACGCGACTCCGCCGTGGCGCTACCTCGCTCAAGCCGCTGAGGCGCTTCTCTTCGCGTCCGGAGACGCGGCGTTCCGCCCATTCCTA
CGTCGGCTCCGGCACTGGGCTCAGGCGTACTGGGAGGCCACCCATGAGCTCTTCGTGCAGGGCGCGGCGTGGAAAAGGTGGCGCACGGCGCGCAACTCGC
GTCACTCACACGCGGGTAACCACCTCAACAGCCTGTTGCAGCTGGTGGTCGGGCTGTTCCAGCAAGGGCTCGCAGACATGGACCTCTTGCTGGACCCAAT
GGTGCTTCACTTTCCGCCCGCGCACACGTCGATCGGACGGTGGTATCCAGGCCTCCAGCACGCGACGTTGCAAGCCGCGCTCGACGACATCGACGCGCAG
GAGCCCTGGCGCCGGTTCTATCGGACGCCGTTCACTGTGGCCGAGATGGACGCCAACGTACGCTGCCGAGTGACGCGCGATCACCCAGCCTTCCATGTGA
CGCGTCTTGCAGGTAAGTTTGTCCAGCAGGTTTGAGTCTTGGCCCATCGTTGCAGTCCGTCGCGTTTAGTTGTGTAGCCAGGGGATCCTCAGAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATCGCTGCTTGAACTTGCCCTGCCTCGTCGAGGGGTCCAATGGCGAATCGTTGC
GCACCTCCGTCCTGAAAGCCTCGACGTACAATTTTTGCTCCAGCAGCGCCTTCTGTACTGACGACCAGCGCATTTGGCGGTGATGTGGGCGTGGGGGATC
AGATGCACGTCCCGCAGCGTCACCTGCAGGTTGGCCACGATGCGGGCCGTGAGTCTCGAGACGAAGGTGCCCTCGTCCTCCTCGGGCTTCTGCTGCTCGT
GCTGCTCCTGACCTGGGCCAACGCGCGCGGCGAAGCGGCGGTGCTGGCGCAGCAGCTCCAGCTGATTCTTCTCGGCCGCGCTGCGCGGCTCCGTGTTGGG
CACCACGAGCGCCAACACGCCCTCGAGAGTGATGGCCATGCTGGCGCTGCCAACTGGTTCCAGGGCAGGCGCACCAGCACGCGGCCCACGCGGCCGCTGG
TCACGGCTACGGGCAGCTGCAGCTCGGCCAGCGAATGCGGCTTTAGTGACAGGTCGCGCAGCTCCAGCTCGCCACTCCACAGCCCCACGACCAGCGAGTC
GCTGCGCAGGCCGGCCACATACTTGCCCAGCTGCGCCTCCAGGATCGACGAGATGATGGCCTTGGCCATGGCTGCGGGCGGCATCGATAGCGGCGGCAAG
GGCCGATGGTAGTGTACAGGATCCGCGTAATCAGATTGTAGCCATGTTCCGTGAAAATAGGTGCGAGCGAAGTAGTGGTTTAACATCAGCACGTCGTACG
AGACCTTGACTAGAGCGGTCTGCTCGGCCGTGAAGCGAGGCAAACGCTCACCGACTCGCTCGCGCATGACGGGCGGGTAGTCGCCGGAGGTGAGGGGCAG
CAGCTACCAGCCAAACTTGAAGTTCATCGCGCGCTCCGCAGCTTCTGCATCTTCAATGTTGTTCTCCCGAAGAGGGTAGAACTGATTGGCATTGAGTACG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGCAACGCGTGGTAGAAGACGAGACCGGGGCGTGGGCGCATGCGTCGC
GCTTCCGGGTCCCAGTTCATTATGCGCGACCACGAGACGAAGAAGCGGAAGGACTGGAGTCCCGTCTCCCCCATGAGCTTGATGTCGTCCGCATAGCGGT
GGTAGAAGTCGTCGACGTTGGCGCACTCGAAGCCAGGCTGTTCACGACAAAAGTCGTCCCAAATGCTCGGAGTGCGGCCGTCCTCGTTCCACGCGCCCTC
CACCTGGTACGACGCGGTGGCCGACCCGAAGAGGAAATCAGCAGGGAAGCAGCGAGGCTCGGCGGCCGCTGCAGGGGAAGAGAGCAGGGTGACGGTCGCC
GCCGCCGCGAGTCCGAGACGGTGCTGCAGCCACATCACTTGAGCTGTGAGTTCGAGGCGGCAACTTCACGAATGAGGCAGGAGCGGATTCGCAAGATCTC
GACGAAAGCGTTGGCGCTACTGTAGGGCTGTTTCGTGCAGTGCTCGAAAGTGCACGAAAGTACTTCGGCGCCATTGCTGCCACGAGCACTTACCGGTACT
GTGTGCTTGTGGCACATAATATGTCGAACAACATACTAGCTTACCCGGGCGACAAGCGTCCCGGGGGAGGTCGCAGTTCGTAAGGCTAGAAATCTTCATC
AAGATCGGGTGATATGTAAGAGCATTAAAAGCGTGTCGTGTGTGCAGTTTGTTAGGTCTTAGTACACTTTAAGCAAAGCATTTTATAGTTTTACATTCCT
CCCCAACGATCCTTTCTGGCATATGCCAAGGAATCCAACGCCGAAGGCGGAGGACCGGTGCGTGTAATTAACAGGTATTTAAGTTATTGAGATGCAGCCT
GGATTGTCGATCAGGTACGCTTCCAGCGTAGAGCTCCAGTAAGAGATTGGCCAGTTTGGGTGTCGCCGTGAAGGCGAAGTAGCAACTGTAGCTGACCCGA
GAATAAAAGAAGGACAAATCTGATTTACGGTACGAAAGGCCACCGGATTGCATGAAATCCCGACGAGAAAAGCCGCCCCACTGGAGACGTCAGCTAATGA
GAATAAAATAAGTTCCTACGTGGGGCCTATTATGTACCCTGAAGAACAGCATAATTCAACAAATAGCAGCGTCAATGTTGCGCCAAGCCCGTACAAAGCT
TATCAACGTAGGAAAGAGGATGGACAAGCATTCCAGAGCTCTTCGGCATCAAAACTATTTCCTTGTTTCGTGAATCCTTCCACAACAAGCTGTAAATGCA
CCTTGCATAGGCAACTACATGAAAACAGCGATAGTAGCCATTAAATCAGCGACAACGCTTTCTGTAGACATAAAATTAGGTTATATTGGTTTAAACCAAG
TATCAGGTTTTACCAGCCCTGCACGAGACCTTGATGCAATAGTTCTAGTATCGAAGTCATCGTGTGGGCATCGTCTCGATTTCACAAATACCTGCACTAG
TGCCAGTGTCAATACCACCATCACGGCTACTCACCACGCCGGGAAGACTGACAACAGCAGTAGATTGATTATCTTCAACCGTGTACGTATCGTCGTGAGA
GGAAAATCGTGCGGGGGATAAACACTGACGTTTAGCTCTGCTGGCCCTCTTGCTGCAAAAGCAGCAACCGAACTGTTCGTCACGTGAAATGCGAGAACAG
TTAATTTCATTGCACTCAACAACTCGACCAGCACCCCGTTCGTAATGGCTACCTTGTGTGGCACAGTTGATCCCAGTATTAGAGCTTAAGCTCCTCCTCC
TCCGTCTCCTAGCAATACCAAGAGCATTAACACGTAAACCTCCAGAATTTTACGTCCCTTCATTTACCACTGCCAGCGCCCCATGTATCCTCACCACACA
ATGCATAACTGTTACGCCTCGACTGCATCCGATCAGCCGCTTCCTCTGGCCGCTGCTAAGATGCTGCATCAAGTCTTCCTCACCGCGAGACGAGACACAG
CGGTACCGCTGTCATCACCGTGGCAATGGCTGCGGTTTCTAGTCATGACGCTTACCCCAACGAGAAAAATCGGAAATGAGGTCGATCAATCTCGCTCCTT
CCAAGCCACAGTGATGTCCGAGCTGTCGATTGTTAGACCACAAACTTCAAGCTCGTGGCCGAGTTGTCGATTGTTAGGCCACAAACTTCAAGTTGGATGG
TAAGTTTGTGTGGACCACCTGGTTAGTACTCTATACACTTGGTTCTAGTATCAAATGGAAGTCCATAAATAATTCAAGTCAGCTGGCCGATCACTCCAAA
TTGATTTGTACCGGTATCTGACAAAAACTTCCATGTAACGACAGTTCTAAACGAACTGCGAATTATGTTGTTCGATTGTATTACATTTTCCTGTGGCCCC
TTATAACATTCGGTGCGTGTGTCAGAGCACATTACAGACATGCCACAA