Description :
From Genome Similarity Track
Location :
Scaffold_97:7976- 11159
Transcript NameFunction/comments
Albla_Nc14066760conserved hypothetical protein
Albla_Nc14066770conserved hypothetical protein
Albla_Nc14066780
Albla_Nc14066790conserved hypothetical protein

Sequence
3183 bases(100 bases per row)
AAGCAGCCACAATTCCTTCTTGGTTTCGTTCTCTTCCGTCGCCGCCGAGATCAGAAAAAATCACGAGGATATTCGCAGCGCTCCTTTGTTATCATTGCAA
ACAAGCCCTATCTGGATCTGTACCAGCGTATTCAGCACGCGATCGGCCCTAGCTTCTTTCAATACGGGCCAAGAGCCTTGATATCGGCTTATCATGAAAT
ACTCAAATGGTATGTTCTTAATTTGCAAGCTCACGTCTCAATGCTGGCTGCCACGCAGGGAGAAGCCTTTGCTCAATCGGGTCGCTCTATTTTATCTGAC
ATCAACGAAATTCTCCTGTGTCATCCCAAGGATTTGTGATTACCAAACCACAGGCCATGTCGAAGAAAATAATCACAATTGTTCCAATACGAGCGCACAT
ATCCTATCAGACGATGAGGAGGGAGATTGGGTCCTAATCAATAGCACGGGTGAAGAAGATACCGTCATGTGCACTCCAGAAAACGCAGGCATGCAGATGG
AAGAGCTTGCGAGGATAGAGAACGACTTTGAGGGTACTGAGAGCAATCTCCCTCCAGCAGACTTTCTAGTATTCGACAAAAATCCATGTTCTTCATCTCC
ATCGCTCTCGGACCTTCTAATTACGAGAGGGTCGCACGAGTACACTGATTATGAAGTATATTGCACGATGGGTCGAAGAAATAAACTGAGGGATTGCATT
CCAGGTCATTGGGCTGTATTCCAGCTTTCGAGGTTGCGAGCAGCAGCTGTGGCTTCTGTGGCAATTCGCCATAACTGGACAGAGGTTGCTCATCCTAGCT
CCGCATGCTCGGAAGGCTAGTCATGCCACATTGGCTTTCATTAGGTGTGTAAAGAAGTGGATATGCTCACTGGTTACGATTTTGTATCGTGCAGTCTGAT
AGCGCCAATCCAGTTCCAGGCAGATTACCGACCATTATATTCCATATATGAGGCTGATTTTGAGGTGTGTGCGATCAAACGGAATCCTTCACTTATGAGT
TATACTTTTCCGCACAGAAGGCAGCCCATAAAAATAATGATCCTGGTTCACGTCGCACTCAATGTCCAAGCGTGATTGGCACCACAAGTCCCTTCTTCAT
CAAGGTAAACATCGGTAATTCTTGAAAGTAGCTCACTTCTTCACACGTGTAGGCTCTCAAGGACTGGCCAGCTGCTCTGATATTTCCTTCGACCAAGCCT
TCATCCGACGGTACAGATTGGATTATGAAACACTCCACTTTCAAGCCAGTTCATCAACGGCTTTAAATTGATTCTAGGTTTTGGAGTATCCATACGACTA
AAGGCGCATGTGCCCCTCGATGATCTCGAAGAGGCTAATGAAATCACGGTTCTGTCCCTCACAATTGCTTAGTCGAGAAATCAGTGCTAACTTGTGGTTA
ATTGTATCCAAGCTTGTACGACGATGCTCTCGTCTGGTCTCTCCAGATACATCCATACTACGACAACTAGTACCATCGTCCAAATCCACATCCTCAAAGC
GTTTCTATAACCCTCCCGAGTCAGATGAAATCATAAACAACGCCATACTTCGCAAGGTTTGAGACTTTGAGGGACTGATTTCGTTTCGCTCAATGAAACA
ATTTATACTTGCAGCATTTTCGCCAATTAACAGAGCATTTTCTACGTCCATTTGATCAGTACTTTGGTATCTGGAAGGCGAAACGAGTAACATCTGTCTG
CTTATATCAGGACATTGAGGAATGCATGAAGCCTTTCGATAAAACGGTAAGTCCAATAGATTGGGAAGTGATACATCTCAAATATTTTTTACCCAAACAG
GATTTCATACAGAGTATTAATCCGCAGACATTGCCAATATGCATTCGTCGTAGTAAATGGAAGCAATTGTATCTGCAGTTTATCGACTCTCCACACTTTG
ATCCCTGGTTTATGTACCGTCGCCAACTCTGTATCCGTCACTTTGATACAGTCATGCGTGCTCTTCGTGGTAAAATCGACCAGGAAGCCTTAACTCGAAC
TCCATGCGGCAAGCATCAAGATCTGGAATCCTGTGCGGACCTTTTCAATGAAGTACAAGACGCATTGGATAAAGAAGAATCTCGCCAAGAGCGCGATGAA
GAGCAGTTAGCTACTATCCAAAATCATCTCAAAATCATTGGGAACCAAATCGATTATCTTAAGAATACAGAACTGTAGGGAGAAATTGTTGTGACTCATT
TGCAGCCAATAATAATCTATTCTACCAAAATTGCGGATAATACATCAACAATCTGACTGGCCGAAAGAAACATGGCAGGGAAAAACTGGAAAAGCGTTCA
ATCGACCGCAATAAGTGTCATCAAGCCTGTAGTCCACTGGGGATTCATTCCGCTGATAATTTACATCGGAATGCGCCAAGATCCTACACTCACGTACGAT
AAACTCTCCTGAAATTTGTATGCAATTGCGTTATGTATGCTGTGTAGGTTGTGGCAAGTGATATGTCCGCTAGCGACTCGTAATGATCCCCCAGCACAAT
TGCAGTGATTGTAAATGAATATATTTGATACGTTACGTCAATCACATGCGATATTGCGAAGCAGTGGCAGTTCAATGTCTGACTTACTTAATGAATCACT
TTCGGTCGCACAATTCTCCACTTTGTTACTATCTGCAGGCGCGCTTCGATATCTTTCGGAATTGGATACGGATTTATTGTGACGTGCGTTGCATAGGCGT
GTCTGAAAAGAGAATACAGCAACACTCCTGTCGACTGATAGCAATCAAGGACGAGTTTTTGGGGTTCCAACGTATTCCAAGCGCTTTGAAATTGTCTGTT
TGGCAGAGATACTGTGAGGCGATCCGATTTACGTTCAAAGCGGCAGACGAACCAAACGGAATATCGATCCAAGAAACAGCGCTATCTGCAGACCATAAAT
AGACACGACGTCCGCCTGTCACAATAGCGAGTGTCGTCCATTCAGTATGCCACTGGAATGATTTGACTGGCTGCAACAGAGCTACGCAAAAATGTGAGCC
TGTGCATGAACACTTGAAGTCTCCTTACTCAAAACAGCGGCAAGGGTTACGTCTTGCACACTCCAGATCCAAATGTTGTGTGGCGTGAGCTCGCTTTTGG
TTGCAATATATCGAGAATCAGCGCTCCAAATGGCACGCTGAATACCCATCAGTGGGATCTCAATGCTACGAACACTTTTGGTC