Description :
From Genome Similarity Track
Location :
Scaffold_1412:7976- 9721
Sequence
1745 bases(100 bases per row)
AGGAGGAGTAAGTGCGACGAGCGTGTTGCCATATCATATGCATTGAAGTGCTCGTCTAAACAAAAGGGAGCCCAAAATGTTTAGACTAACACTTCAAATT
GGCCGGGATGCGTCGACGGAATTGAACTTGCCGCCACAATCAATCGCAACTTCGCCTCGGTTTGGTCATGCTGGTTCGCGCAGACAACGAGTTCGTGGCT
ACCATACAGTATCAACCCATGGCGAAACTCTGGTCTGCACCCTAGAGACGGTTTGCGCCGCCACCTCATGCACGGCGTTGTTGGAACAATTTTCAAGGCC
AAAGACACCCCGAACCAGTCTGTAAAATTTGCATTTAATGCACCCGTGTGGTCGCCTTACAAGTGTCTTTGCTCCATTTTCTTTATCGATGCAAAACTCG
ATGCAAACGATCGTTTAGTACATGCACAGGTATCGCTGCCAACACGAAACAGACAACAGCTGTCGACCATCCGAGCAACATTTCGCTGCTCTCGTCGCGC
CTCTCTCGCCACGGTGTGGGCAATCGAAGCCACCATTATCCACACCACAATGACAATTACCCGTAGGTAGGCGCGTGCTTGCAgccgtgttcgacgagcG
CTCAGCTCATATTCAAGTAAGCTGTAGCACCGTTTTCACGCGAGGTCTTGTCAACTTGACAAGGGAATTCTTGAGACCGTCAAGTTGACAAGACCTCGCG
TGAAaacggtgctgcagcttaaaaaaaatgattCGCTCGTTGACACTATCGAGTGTTTTACGAAAGAGTTGTTTAGGCCGTTTTCGACTTTGATGGTGCC
CGCATAGGCTCTGCAAAAGTGTTAAAATACAACCAATAGCGTAAGTCGACACAAAAAGCTATAGAGCTGCTTCAATACGAAGGTGTCAAAGTGAGTATCT
ctgactacatgtatcgacAATGCTACAAACATGAATGTCCCTGGAAAGATGCGAATCAAGTTAAGCGACGTTTAGTAATGTAACGTTATTAATAAGCTTA
CGTGTACATTTATACTAAAGATTTTGTGGGTCCGTGAACGTGACGAAGGATAAGCTACTACGCGGTACGCTGCCAACTCCACTACCGTGCGACGTTCAGG
TAATCCTAGACGCTCGCGCTGCCATCATGCAGCGCGTAGCTGCCCCATCAACTGTGAACACCGATGATCTGGAGCCTTCTGACCTCTCTACTAATGTGGC
GGAGCACGCACGCCAACATCTCATAGCTCTAGTCTTTGTTTTTCTTCATTGTCGTGCATTTCATCACTTAGCAGTACGAAGCGGATCTCTACACTTGAGG
AGCCTCTGCATAACTAATATTTCCAATTTTCAACGAGGCGGAGCGCTGCGCAATTTTTTTTCAAATGCACGTTATTTTCCGAACGGAGGTAAGCTTAGTA
TATGTGTGGATCGCTTGCGCTCCTTGATAACTTTTTGATTGAGGACTATCCTCGCAATATGCTTCGAAGTAATCCTTTTTTTCTCACGAAACGTATTATT
AGTTGACGTGTGCTACTGGTACAAAACGGTTACAATCGTCGTGCTAAGAGGTACAAACCGGTCACAAACGGTTTTGTATCGTACAATCCCCGTTCAAATA
TATCCCAATTATTGcgaaaaccggtcagaatgtccattgccaatcgcccacaaatcggggatttgaactaCACATCCTCAACCTAAATCATACGCCACGA
AAAAtatttagaggtctaaatgaggTTAGGGTGACCTTAATCCGA