Description :
From Genome Similarity Track
Location :
Scaffold_25:7976- 25386
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.26Transcription factor jumonji (ISS)
Pytul_var.sporangiiferumsnap_masked-pug3_contig_25-abinit-gene-0.72Outer arm dynein light chain 2
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.28Conserved gene of unknown function
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_25-abinit-gene-0.78L-allo-threonine aldolase
Pytul_var.sporangiiferummaker-pug3_contig_25-fgenesh-gene-0.9Chloride Channel (ClC) Family
Pytul_var.sporangiiferummaker-pug3_contig_25-snap-gene-0.31GRIP and coiled-coil domain-containing protein 2

Sequence
17410 bases(100 bases per row)
CGACGAGGAGAGTGAAGGTGCTACGAATGCGAAAAACGCAGACGAACAGGACAAGATGTCGCTGTTGGAACCAGTGCTAGCGATGGCGGAAAGGAATCTC
GACGATATCAGCAGTCTCGAGTTCCGGGACGAAAAAGTCAAGTCGCTGGAAGAGATTGAGGTTCTAGGCATGGACTCTGAGAGCGTCTCTTTTACCGATG
ATGCCGTGAAAGTCCTGGAATCGTGGCGAGACCAACTCGCTCAAGTCTTGGACGAAGGTGATTTACTCAGTGCCACTGTGCCCGAACAAAAGTCGCTGAC
CACCATTGTGGACTTGTTGACGTGGCTGCAGAGCGCTCGGTCGCTGTTTTACGATGAGATGCTCCCATTAGGTGAGCTTGTGTCGAGAGGCAAGGAATTG
CAGGAGGAACTCGAGAGCATACGGTCCCAGAGTGAGATGAGTGCGACAACAATGGAGGTGCTGGACTTGATGCTGTGGCCGATTCCGTACTTAGTAGCGC
AGTATACGATCGTGCAGAGTTGGAGTGAGCACGTGAGCAAGTGCATCAAAGACAAGCACGTGCGTGTGACAACGATTCAGAAACTGCTCGACGAAGGTAG
CAACCTGCTGATGGAACCAGATGCGTTCAAACCGATCCATGATGAAGTCAAGAAGGCCAAGGCATGGCTCACGAAGCTGAAGAAGCGCATCAAGTCGTTG
ATGACCAAACGTGTGGGTCGTTTTAGTATCGGTGTCGCGCGTTCGCTTGTGGAGGAGTGCGAAGACTTGGCCATCGATATGCCAACCTTTGATCTCTTGA
AGGAGCATGTGGAGACAGCAAGCGATTGGGAGACTCGCGTGCTCGAGTCGGGCATTGAATCTGGTCACGCACGGATCGCCAACCTGGTGAGCCTATTGAA
TGAGTACGAATGCGCACGGCTTCTTATTGACCTAGATATGCATCGCGAGGTGCTCAAGTCGGCGACAGAGCGCTATTGCATTTGTCGACAACCGTTTGAT
GGGCTGATGATCGGGTGCGATTTTTGTGATGACTGGTTCCACGACAATTGTATCGGTATGTCGAAGGAAAAAGCAGAGAAAGTGGAGAATTACACATGTC
CGTCGTGCACAATACTGCAAGATCTATCGACTGCGATGCAGGAAGTTGTGGGCGAGCAAAATACGCTCTGGGATCAATCGGAGTACGTGAAAAATTACGA
AAAGCAACACGGTGTGCTGGTGCGGAAACTCAAGCGCGAGGAAAAGGCGATCGAAAGAAGCGAGACCCTGCTACTGAGCTGCAACAATCAGATGAGCCAC
TTGCGCACACGTATCGATGACATAGAGCGAAATAGGACCCAAGACACTTTGTTTTCTCCACCAAAGCAACAGACTGCAAGTACACAGGCTTCACCAGCAG
AGACCCCAAGCAACCCTCCGGTAGCGCATCAAGAGAGCGAAAGCAAAACGGAGACACACACAATATCAGCACCGCCCGATGCCGCTGACAAGGTTGTGCG
AAATGTCTTGAATCAAGCCCCCAATCCTGGAGCACTCCCACCAGATATCACTGGCGCTTTTGCGAGTTTGCAATCCGTTGGCTTTTCTCATCTGTACCCA
AACATCCTGCTGCCGCCGCCGTCATCTGCTCGATACAGCAATTTGGCCCCTCATCCGCATCACACGTCAATCTCTATGCTGCCTCTGTCTCATCCAGATT
CATCAGCGAAACCGGTAATGGGTGATGCCAGTAGCACCAACAGCAGCGTCTCCAAGCCGCACGTGGTCAAGAATGGCTCGGCAAACATGGAACGCTTGTC
GGCACTCGTTGCGGCGGCGGGAGGCGATATGGACCAGCAGCTCGCGGCAATGAAAAGCGAGTATGCCGAGCTGATGGTGCAAGCCCACGATACGAACGAG
TCGCTGCGGCTGAGCAAAGAGCGGCTCGAAGCGACGCAAACGGGATTGCGCGAGCTGAAGCGGACTCATGACGCGCGCGAGCGTGNNNNNNNNNNNNNNN
NNNNNNNNNNCGTAAAGCCGTCGTGGCACTCAATGCGACGTCCACAGTGCTGCGCCGCGCGCAGATCCAGACGGGCAAATTTGTCCCCGAGGCGTACGAA
TCCCTCCTTTCCGAGATCACCACCGAGAACGAGGAGCTACAGCTGGACCAGCTTTTTCCCGAAGTCGCCAAGTATATGCGGTTGCTGCGGCTCGTGGGTT
GGAGTCTCGTGGTCGTGTCGCTGCTTCAAGAGCGTCCGTCGCGTGAATTCTTGGCCATGGCGATCGCGTACGCGGCTGAACACCGTCTCTGGGAATCCAA
GACCGTGAGCCCAGTCAAAGGCGTGCTCGGACGAATGGATGCGTGGATCTCCAAGGTGCACAAATCCATGGTCGCAAAGCAACAGCCAGGCAACAAGACT
CAAAAACTTACCCGATGGAAAGTGTTTCTGAACGAGTACTCCAAGCTTCCGCTGACGTGCACCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCTGGAGGCGTATATCAACGCAGCAGAGTCGGAGAAGCTTTCATCGGCCTCGTCGGAATCGGCTCTGGATGCAGCAGAGAATGCGGCCATCGCTGCCTTC
ACCGCAGCTGCGACAGCGCTGTTGATGAGCAATAACGTGGCGGCATCCTCGACTTCAGCTGCACAGCCGAGACCCCCGCGCAAGCGCAAGCCGTACACGC
GGAAAGAGAAACCGGCTGGGGGAGCCACAGCAAGCAGGAGCAACGCGAAGAAGAGCAAAACGAGTGCATCCGTGGACGAAGATGCGCAGACAAATGGCGT
AGGTACACCACCATCGGCGCTATCCATACCTGGCGAGACAAGAGCGACACCTGCGTCGGAGCCATGAGCATTTGGAGAAGTCGCGGAGGTTACCGATACC
GAGAGTGATGAGAATAAAGAAACACACAGCGATCAGCAAAGGCGGTAAAATGAAAATACGAAAATGGCGAACATGCAAAAGATCGATGTGTGTGCGTGGG
TGTGGTGATCGCCTTGTGATTCACGTATGAACTGACCAAGCCATTCTTTGAAATGTGCTGTTAGCAGTTACGTCTCATTGCAAGAAACACGTATTTCAAG
GTTTGGGATTCGTGTGCTGTGATTTATTTTGGTGGTGGCTTTGTAGGTCCTCATCAAGCGCCGGCAGCTCCAGCACAGTAGACAAGCAATGACGTTCAAA
GTGCTTGTGCGTCGTGTACTTTGGCCGAATTAATGAATTCGCCGACCGACTCAAGTGACAATGACGATGACCACCATGACTTTCTAGACTCCGTGCGCTT
TCAAGCCCACGGCGATGATCCGAACGACCAAGATGGCAATGCAAGCGAGGAGGAAGATGATAGTGCTCAGTGGACGCAGCTTGTGTTCCAACGACCGTGC
GAGGCGATGGTGCATGTGGAGCTGTTTGCGTCCGGCGGGTACGACCACTTGCTGGTACTCAACCTGCAGCAGAATGCGATCCAGGATCTGTCACCTCTGC
TGTGCGTCGCGCCGACGCTGCGAGTGTTGAATGTCGCGCAGAATGCGATCGCACAATTGCCATCTTTGGTGGCATTCTGGAAGCGTTTTCAGCACTTGAC
GCTCTGTTTCCTCGAGGGAAACTGCATCCGCAATTGGAAAGACATGGACGGACTGCAGGCGTGCAGTGCGACGCTTCTGTGGCTGACGCTCGAGGGAAAT
CCGATCATGTCGCTCACGAATGCGCGGCCGTTTGTGATCAACAAGCTGCCGTTCCTCAAGGCTCTGGACTCCTTTGTCGTGACCGACCATGAGCTGATGA
AAGAACCAGGTATGAGTAATTTTCCATTTGCTATGCTGTGTGAGTATTGCTGACATGTTTCAATGTTTGCCAACAACAATAGGGCCAAGCGCAAGATTTA
TAGCCTTGTCGCCATCGATGGACGTCTCGCAGCTCCGGATGCCGCTCGAGTTTGCTGACAACGACACTGCGCTGCTCTATTTGAGCACATGCGAAAGCGA
GATCACGCGACTTCACGCCCGCAATAGGTGAGGTGCAACTATTTTTTCCTTGCTGTGCGTACTTGCATGTGGACCAGTGTTGAGCTGCTGTATGTGTCTT
GTGCTTTAGCCCAAGCATCGTCATCCAGCGCAATGTGCGCGGTTTCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNCGGCGGCTCCAGTTCCCACGACTGA
CGCACGTCTGTGCGCTCGTGACGATGGTGCAAAAATGCATTCGTGGGTTTCTCTTCCGACGCATGCTCGAAAAAGAATTCCATGAGCTCGTGTGCACTCG
TGGACAGCAGCACTACTTTCTGCCATTTGGTGGCGAGCCCAACGAGTCTCTGCTGCTGTTTCCGTGTACCGCGCGTCGTGGGTTGAAGGCGTTGATCGCG
TACGTGCAGGCGTGGAAGCATGGGTTTTACGTCAAAAAGCAGGCGATCGCGATCAAGAAGATCCGCTTTTGGTGCCAGATGGCGTACCAGCGGTATAAGT
ACAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGACGAGCACCAGGTGTGCATCTACTACACGCCGTGTCTGGAGCCCGTTTTGCTC
GCGGCCGCAGAGAAAGCTGCGCATCGCGATCCGTTCCTCATGGCCATGGCATCTGCAGATCGCACACAGTTTCTCAAGCAGCGATGTCTCCCAATATCTG
GCGTCAGGGTGCTGCGCGTCCCACAAGCAACGACAATTCGAGCGGGCGGCAATCCTCCAAGCGTTCGACGAGGGCGATGCATACGCCGGGATGGCATTGG
TACGCTCAATGCTGCTGCTGTTGGAGACAAAGGCGGGCCGAATGCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCGCATGAAAATCA
TTTACTCATTAGCGAGAAGCAGCTTCTGCACCAAGACATGGAGCGTATCGCGAACCTTAAGCGACAGCATCAACTTGCAGTGAGCCAGACAGACACATCG
AGCGTGGAGCAGGACAACGAGAAAAATCAGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTTGACGCATTTGTACCTTGAATTGGAGAAGCG
ACTGGTGATCTGCAACAAGAAGATCCTGCACGCGTGCATCAAGCTGCAGGACTGGAAGACGCGACCTCGGCCTCGGTTTTCGCTCTCACGTGTCCGCATT
AAGCCACGAGGTCACCCACTCATGCGCTGGGAGAAAAATAAGATCAAGGCGCTTGAGACAAAGCAGCAGCAATTGAGAACGAATGACCGGCAGTACCCAA
AGATGCATGCGCTCATCCCCTGGAGTATCGATATGTACTTGCAGATCCTGTCGCTGCTCGATCGCCACAAGTTTAGTACGCCTCTGTCGTCATTTACACT
CTCGTATGAGCAGATGCGCAAAGTGCACGCCGCAGTCGCGATTCAGTGTGCGTGGCGAGCGTTTGTGAGGCAATCAAAGCGTCTGTGCGTCGAGGTCGCG
ATTCAGCGCGCGCGAGTGTGTATCCAGCGCTGGTGGCGCTTCCGCATGGGGCTACGGAGACGAATGGATTTCCTACGAGCCTGCGTGCTGCTCGGCTCTT
CGATCACGTCGAGGACGCTGTTCATGGAGGAACACGTGTACCGATTGCTGTCTGACGCCGCATCGTGGGGACTCGTAAACGCAGCGATTCGGCCATGCCG
AGAGCATCATTTGCATTGCCGCATGGCTGAAGGAGGCCACGTGCAGATCGCACTCATGCCTGGCCAGGTCAAGCTTCGCGATGCGTCGGTACGCGGACGC
TGCTGCCTCCTCCACCACCACCAGGGTTTGTTCCATTTGAGAGAGGCCGATGCTGTGAGCACCCAGCGATGCGGGGCGTACTTCCCTGTGTGGCTTCCTG
GCACTCCAGAGCATCACGAAGTGTCCATGAGTTCGCGGGACGAGGACGCCACACCATTGCTCCTCCTGGAGCGCGTAAACGTGGAGCCAACATTGCTGGA
GCGGGAGCTGATGATAGGAGAAGCAGCAGGAGGAGGAGGCACCATCAGCGACTCACAGCACCACGCAAATCACCACCCGTATGAATGCTTTAAAATGCGC
GACCAAGTTGCTAACACGTCTTCCCAGGTTATGGCGCTCGCGCGACAGCTATTCTCCCACCCCGCAAAGAAAGCGTGGCAGATGCAGTCGACCGTCTTGG
CGCTGGAAGCGACATCTTTCGTGCGTCTGACGTTCGAGTCGATAGAGGAAGCACAACGACGCGCACTCGTGCTATTGGCCAAGACGTACGATCCAGTCAC
GAGGAGCTACGCGCGATTGTACTCAATCGAAGCGCTCTTTGGTGCCGCGTTACGACATCACCAGGTATATTCTCATACAGCTCATGATTTATCTCATGGA
ATTGTCCGTTTATTCACCCGCAAGTTTGTCCACAACTTTTTTGTTTGTAGTGGGCATTAAGTCAAGTCGTGAGTGCCGAAGAGAGCCACGAAGTGCTGAC
TGGATGTGCAACATGGCTTCACGCGGACTTTCCGTCACCGTGGTGGCTTCATATGCAGAAGAAGCTGGGTTCGTTGCTCCCAAGTGGTGGCGCATCTTTG
CCTACGATGCCCTCACAGGCAGAGGCTATGGTACCACAACCGCAATGCCAACGAGGATTCCCAACGCAAAACCCTCCATTCCAAGTAATAGTGCCGCAAG
CAACTTCTCCGTCGTCGACGATGATACCAAGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGCAACAGCAGCAGACCAGCACCTTTGCATGT
GATTGTGCCTGGCGTATCGAGGGTGGACAAGTGCAGCAGCAGCCTAGCAGCGACGACGCCTACCCACTCGTCACCACATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCTTTGGCTTCAGGCGGTTGGAGTCGCCACCAGCTTCTCACAGACCGCATGGGCAAGCCAAAGTACGACTCGGTGGACGA
AATGCACGAGGAGCAGCTGGAAGAGCGTGAATGTCGCGTCCGCGACCTTCGAGAAGAGCGCGAGCGTGCGATGGAGGCGCTCATCGTCGACCGCCGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAAGCTGCAAAAGATCAAGTACTCGCGCGAAATCGATAGACTCCACG
TGCGCGACTTGATCGAGAAAAACCAGCATGCGAAAAAGCGGAGCCGACTCACGCGGAGATTCGAGACAGCATTTGCCGCGCAATCTGGCGCGATGATGCG
GCTCGCAGCACGGGAGGCGGTCACAAAAAAACACGAAGCGCGCGAAGAAGCACAGAAGGAGCTAGTGTCTTCTGTCAAGTCACGCGCCGCCGAGGAGCTC
GAGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGACGCCAAGAGCTACTGGTTCGTGGCCAACCAAAAGGCGAAACGCGCGCTCAGCAAGAAG
CTCATCACTGAAGTCGAGAGAATGGAAGAGAATGCGCACGTTCGGCTGGCACAGATTCGCACGCGGATAAAGGAAGACAAAGAGATCAAGCAACTGCTTC
GATTGATGTAGTGAGCCTCACTCAGTGTTGCAAAGTGAGCTCTTTGGACAATGTTGTGTCTCTAGATGACCAAAGGTTCTATAGTGAGAGAGGTGGCGGC
AGTCGCTACTTACGTCATGAGGTCGCGGATAGACGACACCGTGTACGCGATGTCTTGAGCCGAGATGTGAAGATTCGTGACCGCACGAACCTTCTGCCCA
TTCCAGTAGCCACCTGCAACCACAGCAGAACGTACACGCAAACATGAAGTGTCAACATAAACTCTCACCAACCAGACAATACGGGACGCAAGGAAGATGC
ACGTACCCCCAACGAGAATGCCCTTTTCGCTGTCGAGTCGCTGAACGAGCGTCGCCGCGTCGAGCTTCGCGTCGGGCGTAATGTGGAAGAACACAATGTT
CGTGTCCACGTCGTCTTCGCTCACGTCGATGCCTGGGATTTGGGACTGCATCATTCAAAGACAAGTAGCGAAAATACCCAGTAAGTTGATCGTCTATGAC
ACGTAATCCCTCAGTTGCATCAGGCTCATTACCAATCCATGGGCTAACGCCTTGGCATTCGTGTGGTCGTCCGCGAGTCGCTCCAGTTGACGCTCCAGCG
CAAACTTTCCCGCTACGGCGATCACGCCCGCTTGGCGCATGCCGCCGCCCAGCGACTTGCGCAGGCGCTTGGCATTGTAGATGAACTCTTCCGTGCCCGC
GAGGATCGAACCAACGGGGGCGCCGAGCCCCTTGCTCAGACAGAGCGATACGGAATCAGCGCCAGCCACCAAGTCCGCCATAGGGATCCCTGAGGCCACA
CTCGCATTTGCGAGCCGCGCGCCATCGATATGCAGCTTGAGCTTGGCATCCTGGCAAAACTCTTCGACCTGGTGAATAAAGTCCATCGGGAGCACGCGAC
CGCCGCACGTATTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGCCCCACGCCCATGTACGCTACACGATAATGGATACATATAAGATGACTGGACCAGT
TGCCGTTACGGGAGCACACGACAACTTGCAGGGGAATGGACAAATAGACGCACCACTTGCACCGGCGCCTTCATACATGAAGATATGCGCCTTGTCGCCG
ACGATAATCTCGTCACCACGACGGCAGTGCGCCCCTAACGCGATCAAATTGCTCATCGTGCCGCTACGAACACAAGGCGCCTTTACTCAGTCATGAACCA
CCGTCATTTCCATGAATGCATCAACCACCATCACGTACGATGGCACGTAGAGCGCTGCCTGCTTGCCGAGTAGCTGCGCGGTGAACTGCTGCAGCTCGTT
GACGCTCGGGTCGGTGCCGTAGACGTCGTCTCCCACGGGCGCGGCTGCGATGGCGCGGCGCATGGCGTCCGAAGGCCGCGTGACCGTGTCCGAGACCATG
TTGAGCGCCTGCGCAGGCCGCTTGGCCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGTCCACATGGCGAGCGAGGCAGTCAATTGCTAAAT
GATTTATTAGAATTCGATATCGGCGCATTCACTAAACACTCATCATGACTGTTCATTTAAGTACGATTTACTTCCGGCGACATTTCTGGTAATTGTGTAT
GCAAAAATAATATAATAATTGATTATGCCTCCTTATATGTGTTAATGAAAGCATCAACATTTATATTGGGTTTTACCCAATACCTCCTTATTTTTATGTA
TAGTTTGAGAATGCATAATGCGAGGTAAGAAAAATGCGGGCTTGCCCATATTTGACCTTGAAGAACGCGAGTTGAACTGCGTGACGAAGATGGCGGAGCG
ACGGGCGTCGCTGCGCGTAGAGGACGCCAAGCGCAAGCGCGAGGGCNNNNNNNNNNNNNACCAACGGTGCTTCGGGGGCGAGCGGCGACCATGGTGACGA
GCCCGTGCTGCGCCAGAACAAGCGCAAGTGGACGCGGCTGCTGCTGCGTGAGCTCTATGATCTCGGGTACAGCGACTCGGCGGCGGCGCTCGAACACNNN
NNNNNNNTGCGCACGGACGCCATGAAGCAGCTGCAGACGTGTCTGGAGGCTCAGGATTGGGACGGTGCGCTCGGATTACTCTCGACAGCAGCAGATGCTG
GTGAAGGATCGTCCGCACAGAGCACTAGCGCGCAGCATGAGTCTGCGAGACAGATCCACATGCGCTCCATGCAGGCGGCGAAAGAGGCGTCGCTGCTTGT
GTTGAAGCGGAAATTCTTGGGTTTTCTCATGAAGAAGCAGCTGCGCGCCGCGCTATCGACGTTCCAGAATGAGATTCTGCCCTTTTACCATTTGGTAGCG
TGCAAGTGATTGTGTTTATGGCGGCGATATGGGGAAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTTTAACATTCTCATCCATTTGTA
TGGAACTGTTGTTGCTACTATTAAAGGAAGAATCAGAAGTGAATGACCTGGCGGTGCTGTTGCTGTGTCGAGACGAGCACGCGCTCGAGAAAGTCGTGAC
AATTCCGTGGCGAGAAAGTGAGCTGCTGACGAGAATTGAGCTCTTGGCGAGTCCGGACGAGATTATTCCACAAGGAGCTCTTCGCGTGAGCTATTACCCA
CTATTTTCTTACCTTATCCACACAACCATGGACATGTGCTCATCATGTGCTTGTGTGCTCTTGTAGCGACTGGTGCATGGAGAAGAAGAGGATGGCGGTG
TGCGTAGCGCTAGCGCATTCGCTCATGACACCCAGTTGAAAGCCGAGTGTACAGCAATCCTGCTCCAGCACGCCAGTGATGTCCTGGATCTCAAGTTCTC
TCCAAATGGAGAGTTCATGGCATCGAGTTCGCGTGATGGAGCGATCGTGATTTGGAAGTTGGAGTTCCAAGCATCATCAACTCAAGTTTCTGTCAAACAA
GTGCGTTCTGACGCGTCTTATTCTCTTGTTGTGTTTATTGTAGATTTGTTGCGCAACTAACTATTACTTTGTGGTTCCTCAAATGTGCAGAAATCGAAAG
CGCTTCATGTGCTGAAATGCTCCGAAGGTGCTGCAGATTGCTTGGCGTGGTCCCCTGATAGCCAATTTGTGCTGTCCAGCGGAAGCGATAGCAGCACCAT
CCAGCAATGGAACCTAGCAGTTCGTACATGCTGAATACAAGCACATACACTTGCTGATCGGAAACTTGCGCACATTTTTTACACTTTGTTCATTTTTTTT
ACAGACTGGGAAATGTGAGCGCGAGTTTCATCACCCCTCGAATGGTGTAGCTCATGTGGAATGGCTGCCGAACGGCAATCAACTTCTAAGCGGTAGTGCT
GAAAAGTCACTTGTTTTGTGGGTACGTAACACTTTTTACCATGATGATGCTTGCTTCCATGCTAAACTACTTCTCCTCTTCATGATCTAGAATACCGCTG
ACGGATCCATTGCGTACCAGTGGGGTGGTCGGCGTATTCTCGACTTTGCCATTCATCCAGGAGGCAAGAAGGTTTTTATCCTGATCTCTGGAGTTGAGAT
TCGCGAGTACGACTTGGTTGCGAAATCGGACGAACTCTTCTTCAAGGGCGAGCACCTGATTTCGTGCATCGCCATTTCGTCTACGGGGAATCATTTGCTG
GTCAATTTTATCCAAACGGAAGAGATCGCTTGTCTCGAAATTAACTCCGAGACAATCCTCCCCAAGTATATCGGCGCCAAGGAAAAGCGCTTTATTACTC
GCCCATGCTTTGTCGGGCAGCAAAACGGCATTGTTACATGTGGAAGTGAAGGTACGGCTGGTACATTCGCTATGATCATAGCCTTTGTGCAGCGCGCTAA
TCAACTGATTCCATGTTGCTTTTTAGATGCGAAGATTTATCTCTGGCAGCGCGACACAGGCCACCTCGTCGCTACGCTGCGCGGCCATTCTAGNNNNNNN
NNNNNNNNNNNNNNNNNNTCAACACTGTCCAGTGCCATCCAGTTCATCCGAATGTGATCGCGAGTGCAAGCGACGATGAAACGATTCGCGTGTGGAAGCT
AACCAGTGGCCACCAATATTGAAGAAAAAGAAAAAGGGACTGGCTCCAGCTTCGTATTTCTATATGTACGCTGCTCCTAAAGTTGTGGACGTGCTATCAG
CAGCTATTGATGTAATCTATAAGTTCATGCTGATGGCAAATTTAATCTGATTTTGTTTATCCGTCGGCGAATCCCTGCGCAGCGGTGCTTTGGAGGTAAA
GTATGCATGCGTGACACTACTAGCATCTGATCCATGGCCGGTTACCCCCCGCTCAGCAATCAGTTCCTTCCCAAGTGTGCCAAAATTGCACCAGCCTGTC
AATTCACACTCTCTCAAGACCAGTAACGGATGACCTTGAAGATGCTCAAAGAGGCGAAACTCGACATTTGGTGTATGCCCCTACCTGTGCGCGGGCACAT
TTGTACTCATTTGTTCAATGCTACTCACAGAGACCTTGGGTTCCGTTTCGAGTTTGCTTTGGCGTAACGGCTCAAAAGCGCGCCACCAAGCGTCTCCGAC
TTTTCCAGCTTGCCGCTTCGGTCTCCCGATTTTGGATTGGCCCTGGTACACCCGTAGCCGAGCACAAGACAACGAATTGGACGGCATCGCTCCGGGTGCG
AATCTCTTCAGACGCGATACCATGTCGAGTGCTACGTATGGTGAGTTCAGGCTAGTAAACATGATCTAAGAATCGCGAGTGACAGTCTCCATACTTCGTG
GACTATGCCCTCTGCTTGTAGACACGTGGAAGCAGGCGAGCTCGCCGGACCACTTTGAGCAGCTTATCCATGTGGACCGCAAGTTGGGCGCCTACACTTT
TCGCCAGTTGTGCGTGCGAACGCTTCGGCTTTGCAAGAATTTGCCGTACTCGCCGGTGAATTGGTTGTATTTGGTTCTCTTGGGGGCGATTAGCGCCATG
TATGGGTACGTAAATCATTTCGCACGTGCTGTGTGATTAGTTTTGATCTTTCTACATGGAACTGATAATGGAGTACTAATGCGCGAAACAAAAACGCACA
CATTTGCACATGACAGGCTCTACATCGATGGCTCGGTTCGCTATTTGTTCAAGTGGCGTCGGCTTCTCATCGATGCGGTTGGCGAGAACTCTGTTTGGGG
GTTCGTCATCTGGCTGTTTTGGTGCTGTTTGCTCACGGTGATCTCGACGAGCTGTGGCCAGTTCTTGTCGTCGGCGTCCGACGGATCGGGGATCCCGAAA
ATGCGCGCGCTGTTCGCGGGTGTGTTCCAGAACCCGCACGATATCCTGTCGTTCAAGACGTTTGTCGCGAAATCGATCGGCACGGTCATGGCGGCCGGAT
CCGGGCTGTCGGTTGGCCGCGCAGGGCCGTACACCCACATTGTCGCTATTCTCGCGTTTCTCATGGGAAGAATGGCGCTATTCCGTCGCGTGCACTTTGG
ACCTGAGAACTTCAACTACTTGCGTGCAGGTAAGCTGCCCTTTTCTATTACTCAGCGTTTCTTGACGACCTCGCTGACAGAGGATCGATTGTCTTTAATA
TGCAGCTGTGGCCGGAGGGATTACAGCGAGCTTTGGATCCCCGTTGGGAGGTGTGCTGTTCAGTATTGAGGTGACGGCCAAGTATTACGAGATCAAATGT
CTGTGGGAAGGCGTGATTTGCTCGTCCATCACGATCTTGGTGTTCAAGATTATTTTTTTCATCAAGCGTGACGTGCTCTTTGAGCGCACGACGTTCACGG
GTTTTGACATGGACTGGGACATTTTCTACTTTGTGCTTCTTGGCGTTATCACCGGGGTAAGCAGCAACCTGCACACTGCTGATTATTGATATGCAATGAT
GCGGGACTCACGGCTGACTGAGTTGCGTTCTATGTTCTTGTCGCGTAGATTGGTGCCGGTATTTTCTGCAAGCTGGCGATCTTGATGCGCTGGGTTCAGA
TGAAGATGTTTAAGAAACTCGGGCTTACGACGCCGTCATACAAGCGACGCCTTGTGCACGTGTTCTCGATCTGTATCGCGACCGGCGTCATCACGTACCC
ACTCAAGATCATGCGGCTCTCGGATCGTCTCTTTGTCAATGAAGTCTTTCGTGATCAGCCACTCAGCCTTCCACAGTGGACTCAAATCACCGAGTGGCCA
AATGTCACGCTGTTCATCTACATTTGCTTGAAATTCTGCACGAGCATTCTTCCTTGTGGCTCACCTCTCTCGATCGGAGTGTTTGGACCTCTTTTCACGA
TTGGTGCAGCTTTCGGGAGATTATACGGGGAAACGTTGATGAAACACTGGAATCCGTCGCAATCGCCAGCCACCTATGCTGTCGTCGGTGCAGCTTGCTT
TGCGTCATCTGCAACGCAGACCGTGTCGACCTCTGTGATTTTCTTTGAACTCACCGGTCAGCTCAGCCACATGATCCCAGTCATGCTCGCGTGTATCGTC
GCGTACTTTGTTAGTGGGACGATCGCTCCGTCCATTTACGACATTCTCGCTGAATGGGCGGGATTACACTCGGTTTGCTACGACTTTAACGAGTACGTTC
TGAACCAGAAGCTCGCGGAAAACAACATGAACCCCGTGAACACGATTTTCACAAGAGAGACGACGTATACCGAAGCGTTGCAGGCATTGGTGCGTAGTCG
AATGCCTTCTCAGGCTCTTGCATAGTATAGCTAACCACTGTGTAACGCTTGCTTCTGTCGCAGAGTGTGTACAAGAGCGAAGAATACTTCCCATTATGCG
ACGACCCAGAGAACCGAATGCTCATCGTGAGTAAAACTCATTCTTTCCCGATCTAGACTCCGTATTTTGAGCTGACGGAATTTTCTTTCTGTGCCATGGT
GCGCATTTTGCAGGGATGCATTCGCCGTTACGATCTCGAGGTTGGCATCGCGCGCTTTTTCGCGGTTCATCAACCAGAGGTAAAGCGTCAAGTGATATCG
TTTTATGGACGAAAATTGTATTCGCGAATCTCAAACCTGATATCTGCTATCTCTTTGCTACTAGATGCCAGCGAGCACAAACCCAAATGTAGCCGCGAAA
ATTCTCAAATTGGTCTCGAATACACTGGAATTTGATAAGAAGCGCAGTGCCGTCGTCGATGACATCTCGCTGCTGAATTTCCAAAACAAAGAAGAAATCA
CGGCAACGAGTGTGGTACGTTGGTCTCTTTTGTTGTTGGTCCACAAGCGCGAGTTGTACTTGTGCTGGTATTAAGCTCAAATTAATTGCTTCTTCGTCTT
TCTCTTCGCGCAGCTCCAACTCGGTCCTCCGTTTGCTCCTTTCACGTACGCTTCGATCCCAATCGAGAGCTACCCACCACAGGTAAGTTCTGACCTCCTT
TTGCACTTGCGAACATCGTATATCAAGCGAGCAATGATGTTTGTTTTTCGTGTAGGTTGGGGAAGCTGTGAACCTCAGCCGGGTTCACAAAACGGCGGCA
ATGTGCATGTGGACGCAGGTGTACGTCGTTAAGTGCGGGAAGCTGCTTGGTGTCATCAACTTGGACTCGTCGCTCACCAAACTGCGACAAGAAGAGGCGC
CAGTGCTCATCGCGCCGTAGCCACAGTCGCCTTGCATTTTGCATCAATTAACGTACAAAGCTGCTGTGAGCAAAGTGCAAGTTGTTCGCCGGATTGCTTC
CACCGTCACCATTTCCGCTGCGATGCATCGACCAGGCCACCAATCAGCTTTTGCATAGTCATTCAATACACTTCTTGTAGCAATACGACAATCAAGTTGC
TCCACCATCCATTTGAGTGCGCAACACTCTGGTAATGATGATAGTAGCAATCTACGCATCAACGCAACTCAAGGCTGGTATTTTCGCAATGATCAGGAAC
CAAACCACAAACGATGATGGGGATATAAATACGACACGCATCACAATACATTTCGCTCGCCAAGTACGAGAATCCCTATCACGCAGCTCGAAGGCAAGCA
ACAAGCACGCTTGAGGTGCTGCTGCCTTGCGCGATTCGCTCGTTATCTTATTGTCGGCGTGCCTTGTTGCTTGAGCGATGCAGCGCAACGAGGTGGACGC
GACGCTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACGCCGCACGT
GTCCAAGAAGGTGCTGCTCAAGGCCGTGCGCATGCAGACCGACGCGATGCGGTACATGGTCGACGAGTTCGACCGGCTCCGCGAAAAGATCAGCGAGATG
GAGCGTGAGGCTCGGAACGCGCAAAAGTACGTCGAGCGCGTCAACACCAAGGTGCTCACACTGCAGGGCCAGTGCGAGGAGACCAACACCAAGGTGTACG
AGCTCGAGGTCGTCCAAGCGAGGCAACAAGAACAGCTCAAGCAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGACGCGTTTGTGGCTGACACAACGCAGCAATTTGCGGTCGTGCGCGCTGATCAGGA
GCTCACGAAGCAGTTTGCCGCACAACTCGAGGACCGCATGAACACCGAGGAAAAGGAGCTCTTCCTGGACTCGGACCATATCCTGCACCACAAACTGTCG
CTCGCCATGTGGATCGACGTGATCGAAAAGGAGAACCGGAAAAAGGACGACGCGATCCGCGAGTGCAGCGACAAGATGCTCAAGCAGGGCAAGAACGTCC
AGGAGATGATGCTCGAGACCCGGCGCACGCTCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGCAACGGATGCTGCTCGAGAAAGCTG
ACAAGAAGCGTGTCGACGAAGCCATCGAAAGCAAGTACGAGGAGATCTGCAACCAGCTGGACAAGGCGCTGGCGTCCGTGCTCGGCGAGGAAGACGAGTT
CAAGCGCGTGAGTCAGGAACTGCAGCAGCTCGTGACGCATCTCAGCGAGAGCAAAGCCGACAAGAAGGAACTCCTGGAAGTCAAAGAGCAGGTGCTCTAC
GACTCGCGGGTGCGGCAGCAAGTCGAGAACCTGCGCTCGTTCATTGATCTCAAGATGAACCGTGACGACGTGTTCTCGGCGCTCAAGAACAAGGCCGATA
AGGACGAAATGATCGCGCTGCTCAAGAGTCTCTCGGAAGGGTACGTGCTTGTTGTGTAGCTGCTGCTGTATCTTCGCTAAACTCTCCACATGTACGCCGT
GATCTGGCATGTTTCTCTGTGCACATGGCTCGCTGGACAGCATGAACGCATCGATTATGCAAGCCCAGAAAACCTTCAGCGAGCCTGAGAATGCGTTCCT
CACGGGCAAGAACGCACTCCCGCAGTCGCATTCGCACCAGCATGGCTCACAAAAGCGGAGTGGGATGCTGCCGAGTCTCGACAAAGAAAAATGTCTGTCC
TGCAACAGCACAATACGCGATGCAAACGCAGCACCGCAGGGAAATGGCTCGCTGCTGAATAAAAATCCACACCAGATGACGCCCGTGTACGGCGGCGGGT
TTGCACTTGGGTCGCCAGCTCCCGCGGAAAAAGGGCTTGCACGAGGCAGTAACAACAGCAACAACAACAACAATCACCATCACAGCGCGCCGTACTTGCC
AGCAAATGCCGCGGCCATGCCGACCGGAAGCGGCCAAATAGGAGGTCTCCTCGACACTACAAGTGAAGGGTACCGATATTTGTTAGACGTGCCATGAGTT
AGTGCAAGTT