Description :
From Genome Similarity Track
Location :
Scaffold_117:79754- 82539
Transcript NameFunction/comments
Physo_142563predicted protein
Physo_142564predicted protein

Sequence
2785 bases(100 bases per row)
TTCTTCAGGACTTCACGCTGCTGAGTCACGAATTCGACTGCCACCCCGTCGTGGCGACAATGGGTGGAGAGGGTAGCTTGCTTATTGCGATGACCTTTGA
CGGCATGCGCCTGAATGTTCCCGTGATACTCTGTGTTTCGACCGACCGGAGACTATTGCAACTGGCGATGCTACATGTTTTAATACCTGTACTGGGATAC
GGTGCCATCGCGGCAAGGGCTGAGCAGCTAGCCTAAAGCAAACCTCAAACAATTCAATCCAAGCTCCTGACGTTCTTCCAGATGAGTACTGTATTGCAGC
AAGAAAGTACCGGTATTACTGTTTTACTTCGACCAGCATTCTCCTCCATAACGCCCCAGGTAACGGACGAGTTTTATGCACGAAAGAGGGTCGTTCTCAT
GGGAGCGCATTAGCCAACCAGGTCTCTCATCTGCGTCAGCGCAGTCCTCGATCACTCCCCTTTCACCCCCGCGTCTGCCCTACTTCACGATGGAGGTGGT
GGTGCTCGGCTGTGGGCCGTCGTCGTCGGTGCCGTCGATGCGCTGCGTGCTGAATCAGAACTGCGTCGTGTGCCTGGAGGCGCACACCAATCCGGACTCG
AAGAACCGCCGCCTCAACCCAAGTCTGCTCGTCCGGAACCTCAAGACCGACACCAACGTGCTCGTCGACTGTGGCAAGACCTTCCGTGAAGCAGCGCTGC
GGATCTTCCCCAAGATCGGGGTATCGGCTGTCCACTCGCTGGTGCTCACCCACGACCACGCCGATGCGTTGCTGGGTATGGACGACCTGAGAGAGGTTCA
AGCCCACGTGGAGACTGTCGACCCCGTGACCAAGGAGCTGTACAAGATCCCACCCGAGGCCATGAAGGTGCACTGCAGTGAGCCCACGAGTCACGAGGTA
ATTGCCAAGTTCCCGTACTTGATCGACAACGAACCAGCCCCGCCCGCTGGAGAGGCAGCGCCCAAGCCGTTCCGATGGACCGCCAAGCTTCAAATTGACG
CGTTCAACCCATGGGAGCCGTTCGAGGCGAGTGGCATCAAGTTCCTCCCGTTCCCGGTCATTCACGGCGCCGGGTACACGTCGTTCGGGTTCGAGTTTGG
CTACGAAGTTGGCGCAAGATTCGTCTACATCTCAGATGTGAGCGAGATCCCGGACGACACGCGAGCGTTCCTGAACGACAAGAGCAAGCCCCCGATCGAC
GTCCTGCTGATCGACGCGCTGTACCTGGAGAAGTACCACAGCACGCACATGAACTTGCAGAAGGTGATGGAGGAGATCGAAACCATCCAGCCCAAGCGAA
CATTGCTAACGGGTATGAGTCATGACTTCGACTACCCCAAGCACAGCGTTGAGTTGCCGAAAATGGGCGAGGAGAAGGGCCTGAACATCGAGATGACTTA
CGACGGTCTACGTATCGCCTTCCCTTGAACGTACGACGCAATATAGACTCGATCAGTGTTAGCGTGGGCGCCACAGTGTCCGTCAGGCTATCATTAACAC
GAATTACGAAGTACTCAGCCAATTGCTCTATTGAAAGGCTGCACTAAGAATCAGTCTAATTCATAATGGTGGGGCTGACCCGGTATCTTGCTTGACCAGC
CGCCACTCAGTTGATCAAACGTGGCTCTTGTCTCCCCGCATTTCGCCTTTTGAGCCCTTCCGAGCAGGCGTCATTATGGACGTCGTGATCCTCGGCTGCG
GCACTTCATCTTCCTCGCCATCTATGCGCTGTCTTCTTGGCAAGGGCTGCTATATCTGTCGAGAGGCTCAAGCGAATCCGGACTCCAAGAACCGACGGCT
CAACCCCAGTCTCCTCATCCGCAACCTCCAGACCAACGCCAACGTACTCGTCGACTGCGGTAAAACTTTCCGAGAAGCTGCGCTGCGTATCTTCCCCAAG
ATCGGCGTGTCCGCAGTGCACTCGGTGGTGCTTACTCACGATCATGCTGACGCGTGCCTGGGCTTGGACGACTTGCAAGAGGTACAGTCTTTAGAGGAGA
CTGTGGACTCGGAGACGCAGGAGATGTACAAAACTCCACCTAATTCGATGAAAGTTCACTGCTGCGAAGATACAAGTCGCGATGTAAGGGCGAAATTCCC
GTATCTCATCCAGGAGGAGACTTCTACACTTCGACTGGAAGTTTTCGAGCCATGGGTACCATTTGAGGCTTGTGGCATAGAATTTCTGCCCATTCCTGTC
ATCCACGGTGCTGGATACACCTCACTCGGCTTCGAGTTTGGCCACGAATTTGACACTAGGTTCGTCTACATATCGGACGTGAGCGAATTTCCAGAGGAAA
CGCGGGTATACCTCAACGACACCAGCAAGCCGCCCATTGACATACTAATGATCGACGCGTTGTATCTGGACAAGCGCAACAGCGCCCACATGAACCTGAT
GCAGGTAGTGAAGGAGATTGAGACAATCCGGCCCAACTCACTGGCATGAACCACGAGCTAGATTACTTCACATACGGCATACTGGTGAAGGAGATCGGTG
ATGAAAAGGGGCTTCACATCGAGATGCCCTACGACGGTATGCGCATAAATTTTCCTTGAATCGTAGGTACAGGTGTAGATTTGTGAAACCGGTTCATCAG
CTTGAACATCAGGCATACTATGACAGCTAACGCAGTGAAATCTTGTTGGGTTTCTTTTACCCCCATCTTTGAAAGCTCTAATCGGTTGTTCCGGCGGCAG
CAGCAGCAGTATCGGTGTTGGAGCCAATACTTCAGTTTCTAATCCACTTCAGCTTTTGCTTCAGTGCCGCCGATGGAACCGGGAA