Description :
From Genome Similarity Track
Location :
contig_22:797494- 798912
Transcript NameFunction/comments
g5761.t1XP_009531999.1 hypothetical protein PHYSODRAFT_336177 [Phytophthora sojae

Sequence
1418 bases(100 bases per row)
GCGGAGGTGCGCGCGCACGTTCAGCCCACCTACATCCTGTACACTAGCGCCTTGCTCGCTTTCGTGCTGCCCCTGCAGTTCGGTTGGTCGACCTCGCAGC
TCAACTGCGCAAGTTTAACAACGTTGAGGATTGCAACGCCCGTCCGGTTGCCGAAGACACGTGCATCATGTTTCCAGGACACACCAAGTTCCAGTGGACT
ATCGTCGTGAACGCGTGGATTGTTGGAGGTATGATCGGTGCTGGTCTCGTCGGCAAGTTCGCCGACAAATTCGGTCGCAAGCAGGTCCTCATCTACAACT
GTGGCTTCATTGTTGCTGGAGCCATTGTTCAGGCTGTCGTGTCGAACCTGTGGGTATTCGCAGTCGGCCGTCTGCTTGCTGGTATCGCGTCAGGCGCTAC
GACGGGCAACGTTGGCGGCTACATCAACGAGATCTCCCCGCCCCACAAGCGTTCGCTACTTGGTGCCGTTCTCCACAGTGGTATCACTGTCGGTATTCTG
TTGGTTGCTACAACTCATTTCTACATGGACTTCGACAACGGTTGGCGCTACATTGCTGCCTTCCCGATCGTGCTTGCGGCTATTTTCCTGAGCATGTCCC
CGTTCTGATGGTGGAGTCGCCCGTGTGGCTCCTGCTGAAGGGCCGTCGCGCGGAAGCCGAAGCTGTACTAACGCGTCTGTTTGGCGCCGAGAACGTGCCT
GTGGCTCTCGAGTGGATCGAGTCGAAGCGCAAGCACGACATGGAGATGCAGTCGAGCACGTGGAGCGAGACGGGCAACGAGGTTGTTCGCAGTGGAAAGG
GTATGCCTTTTTCGGAGCTGATCGCTCCCCCTCTTCGTCGCCAGTTCATCATTGCCTTCGGCGTAGCCGTCATGCAAAAGATCACGGGTATCAACACGGT
GTTCTACTACTCGTCGGATCTGTTTAACCAGGCTGGTCTGAGCAACGCTCGCGTAAGCGCTGTCATTATCGACATCGTGAACATGCTGCCGACGCTGGTG
TCGGGCTTCTTCGCGGCACGTTTCGGAAACCGCCGTATGCTGCTGTGTGGTCTTGCTGGCATGTTCGTGAGTGCCATCGGTGTGACGCTTTCACTGTCGT
TCAGCTGGTCGGCATTGTCGATTCTGTTCATTGCCACGTATGTGGGTTCGTTCGGCGTGAGTCTCGGGCCGCTCATGTATGTGGTCATCGCGGATATCTT
CCCCGACTACGCTCGTGCTACCGTGACCTCAATTTGTGTGCTTACGGCCTGGTCCGCTAACCTGATCGTGGGCGTTGGATACCCGTACATTTCGAGCGCG
CTGGACGACCTCGCGTACCTTCCGTTCGTAGTGCTGCTGGCGATTTCGTTCGTGTTCGTGCTCATCCTGCTCCCGGAGACGTCTGGCAAGACGAACGAGG
AGATCCAGGACGAGTTCC