Description :
From Genome Similarity Track
Location :
Scaffold_22:79747- 104764
Transcript NameFunction/comments
Physo_248056Hypothetical protein
Physo_536838Hypothetical protein
Physo_536841PREDICTED: probable nitrate excretion transporter 6-like
Physo_536835Hypothetical protein

Sequence
25017 bases(100 bases per row)
GATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTTGGCAACACTATGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGGATCCACGACG
ATGCTGTTGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTATTATATCGGGCTCTTCCACGAGCTCCGATACTTCTCCAGCAAGAA
AACTTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGAGAACTTCAACAAGAAACCGGCTGCTTACCGCGAG
CGGGTTAAGCATGCCCGTGAACGCTTCGAGACATTCTCGACGCACGGGCGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCGTGCGCTG
TGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGTGCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGCAT
CAAGGAGCTCCGTGCCAAGTTCTTGGCACGCGAATAATGCGACAACCGTGGGACTTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCG
GCAGTGCGTGGTGAGCTCCGTACTCCCTCACCATTTCCGGAACGTCCTACAGCAGGACGTCCCGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCT
CCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACACTCAACAATCTAGCGTGTTGAGCCGCGGGCGTCGCGG
ATCGGAGGCGGCGGTGGTGGGAACACGTCACGGGTATGGTCAACCTGGGGTTGACCTTGGTCCGACGCTCGAGGATCGGGTCGCTGCAGTGGAGCAGCAT
CAGAGCCGGGAGTTCGCCGCTCTGAAGCAGGAGGTGGCGATCCTGAGGGCTCAAGTCGCTCAGGGCTCGCAGACCGCGTCGGACATCTCTGTCGACGTGG
GAGGTCGCGTCGTGCGCTTGGCCCAGCGCGTTCACGCGCTGGAGCAGAGGTTCGCTCCCGCCGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTTG
TGCTGCCGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGTTAACA
CCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGCTTAGGCAGGTTTTGAGTACTCGTCTGGCCCACCTAAGA
AACAACATTTCTATCTGGCCGTCAAACAAAAATCAAAAATTATCAGTTGGGGGTAAACAATACCTCAAAATAAAGGTGAGATTTGGTGTTTTCGCGTCAG
CTCATTGGCTGCTTGAAAACAGCAGGATTCAAGGAAACAGAGCAAGTTTTCTAAACCCGGATTTGGGTAACATTAGGTTTTTTTGCGTAATGGCTACAAA
TTTTAGCGATATTCAAAGTGATAGGTACCATTGGGAAGATCACTTAACTGCCGATGCGGAGAACCATCGTAGAATATGATAGCGCACCTGTGGGCGTTGT
GGTGCTCGTATATATTTTGAGGTTTTACTAATCGATTTCGTCGATTTGCCGTCCAGTCGAACTTTATGTCCAATCATGTGGCTTAAGTCCGATTTATAGT
CAATCCAATGCGATCTGAAAAAGTTGAGGTTTAATAGAAATGTTGTTTCTTAAGTGGGCCAGAGTAGTAGCTAACAAAACCAATGAACCCTTCTTGAATT
CATTTGTGTTCCCCCTGCCAACGTTGTCTGCGTTCAGCTTCTGTCGATCAACAGAAGCTGCAATAGCGTCTTGGACAAATCGAATGACGGCTTGTCTGCG
CTGCACGAAGTTGATCGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAATAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGGGCCCTGCACA
GACCCGTTCTTCTTCATCTTCTTCTTCTTGCTCTTGTCGGTGTCTGTGCCCTGCACAGACGCGTGCTTCTTGTTCTATTTGCGCGTAGTCGCGGCTGACA
CTGCGCAAGTGTCAGCGGCATTCTGCGGCTGCGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGGGCTTTATGAC
ATTCACGTAGAACGGCGTATGCCCGGTCGAGGCATGTACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGA
GCGTAGCTCTTAAGCACGTCTATGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATTGAAAGTTGACTCCCAA
GAAGTGTAAACACTTCGTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGACATGCCATAGTGTTTGAACACCATGTCAAC
GAACAGACGCGCCGTCTACTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTC
CCCTGGTTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACACGGACTGCCAACACTCTCGTGGAGTTGGAAGTGACTGCAAGGGAGCCTGCGCGAAAG
GCGCAGGTTTCACATGTCGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGGTCCAGTAGAAGTCTCGCGTGAGAAGAAGGTA
TGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGGTACTCATACATGTTCCTGAGTCGGAGGTCATGGTCATTGGGCACGACAACGCGGTCC
GCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGTAACGGTGTGCACGAGCACGAAGATGCGTCGGCAGCTTCTGACGAGCTTTGC
CAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTTGCGTCCGCGTCGTGCGCGTACGCGACCTTCAGTCACTCGCGAAGTTCCGAGTGTATCTACTCGGA
AGCAAACCGTTCGTGGTTATACGGACCACGCGTCGCTGCGGACGGCCGTGAAGTCGCCGCACATCCCGCAACGGATGGCGAGATGGCTCTCATTCTTCGC
AGAGTATAACTTCCGGGTTGAGTACAAGCCCGGAAGACTCAATGTGGTGGTTGCGCTCAGCTGCCTTCAGCTGGCGCGATTGGTAGTAGACGATACGATC
ACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGCCGGATGCGTCGCACACAACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAG
ATCGGCGCCTCAGTCAAGCCCTGCATCGAAGGCCTGCTGACACTCAGCAATCCAATTCCACTCGGCATCCTTCTTCAGGAGCTGTGACAGCGGGCGAATC
GTGCCCGCATAGTCCTTCACATACTTGCACAATTACGTGACCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGATGGGGTCGGCCACTCATTGATCA
CTCTGAACTTCTCAGGGTCAGGGCGGATACCATTCTTCCCAACGAGACACTCGAGCACGGGTATCTCGCTCGTCCCGAAGGTGCACTTCTTCAGGTTCGC
ATAGAGCTTGTGCTTGCGCATAAGTGCAAGCAGCCTCCGGAGATGTACCTTGCGCATCTCAACATTGCTCATCCCGTCCGCAGCCCAGCTGTGAAAGAAC
ACATCGTCGAAGTAGCTTGGTGGGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTACTTCAGACCCTGCGGCA
TCACTAGCCACTCCCAGAGCATGCCGCTTGGCGTGCTCACAGCCGTGAGAGGGATATCAATCTCACGCATGAGGATCTGATAGAATCCATCGCGCAGATC
AAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGCGTCTGCACCGGTTTCGTCGCATCGTTCAGGTTGTTG
TACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGCCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGAC
GACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGGGGCAGTGGCCACTGCCGCGTGACACAATACTTCGTCCCCGGCACGAGATCAATCTCGTG
CTGGATGCCCTTGTCCTGCGGAAGTTCCGCAGGGATCTCTTCCGGAAGCACGTCCGCGTACTCCAGTAAGATCTCGTAGAAGGGACTCGTCTTCAGCGAG
TCCCAGCTCTGCTCCTCAAAGCGCTCCTTCTCAGTCTTCGCACTGAGAGTGTCCTCACTCTCAGTGGTGGCCTCCATGAAGAACTGCCTCAGTTCGTCAT
TCTCGCTCTTCGCCCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAG
CGAAGTCAACTCCGACGCTTGCGTCGGAGGATTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCGAGACGTTGAACGTCTCGACG
TCCCGCTCCTCTGCCTCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCAACCTTCGCATGCGCCGTCTTCTTG
TTTTATGGAGTCCGGCTCCGCTTCGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTTATACCGCCGGCGGGTACATCCCGCGGGCG
AGCGACTTCAAGCCCGGCTTGGTCGCACGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCAGGACGTTTGCAACCGTCC
GCACCGCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCCTCACCTCGACACCTGTTATTGGCGGAGCCCTTTATTACAAGGGGTGCGTCGACTCCCG
GAGTCGACGCGAAGTTCCTTTCGCAGCGCCGGTTCCCGGAACCGTCGCGACTTTAATACCTCGACGCCATCGACTCCCGGAGTCGACGGCGTTACGTCAC
ATTGGCTCTTATTATTGGCCAGAACTGATCCGATCAGATTCGCGTCAGCATCCACGGCTGAGGTGTGTGACTCGCCTGCGTCATCCGCGCCCTTCGGGGC
CAGAGACGTTTCCTGATTCGCTGAAAAGCGGGTGTCGACCTCCGAGGCCAACAGATTTCCGTCATTAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAG
GGCGGTCCGGGACAACGGGGTTAGGCGCTGTCTCGAGTGGGGAGTCGCGCTCACCTGTCGGTGCGTGTGTTGCGGCAACAGGGCCATCGCTCGCTGTTCC
CCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTACCAATCGATTACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTACCG
TCCAGGTCCAGGACGATAAAGGGTTCGACTAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCGCTCGTCG
CCAGTCGTACTTCCAACATACTTCGAGGTATCATTAAATCCTCGAAGTCAAGCCTCGATAGACTTCGCGTCGAATAAAGTTCTTCGACGCACCAGAATCT
ACCAAAGCGCGAAGAGAGCCGCTTGGTCTCATTTAGTTCACATTTGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAATCTCACTGGGTGCTGCAGTCCT
CAGTGTCGCGTGTCCAAGGACGACACGCGGAACCGCATTACCAGTAGGGCGCTCCGCGCCTACTGGCGTCCAGCTTTTTTTGTTTGGTTGCGACGGTTCC
CGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACTGACTCTACCGCAACGGTAGCATCGCACGTTGTTTCC
CTGCGACTGCTGGGCTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGTCCTCCCGTCCTCACTACCAGGCGTGGCTGTGGCCTCGGCACATGT
GCGTGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGGTAGGTCTTCA
CAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGC
GTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTGGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGTGGCTCAAACGCTTGTCTGAGCTTATCC
TTGAAACCCTCGTACGTGCTAAAGCACGTTGGTTCCGAGAGTCGGCGTCCATACGCCTAACTTCTTGTACGTCCGCCAAGACATGACATGGCGAACGCAA
CCTTCGACAAGGGGTCGACGATACGTCGAGCCGCAATGGCAGGGTCGAGTTCGACAAGCCAACAGAGGAGATGTTCACCCTCTCTTCCGACATAGTTACT
CACATTGATCTTCAGCGATTGCGTGCGTGGTGTCGTCCCGGCGGTAGTAGCAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCGTGT
TGCTCTGTCGACGTTAGCATACGCAGCATCGTAGCTACAGCCGCCTCAACAATGACTGTTGATAGTTATTGGAGGACCTCCCACTCTGGATTCGACAGGT
GGTGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGG
TGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACCTTGGCTCACTACTTCAGGTTACACGTGTGCG
CACGTGTGTGAGGATGCGTAGCTTAGTTTAAACTAGAGTTAATTATACTCGGGCGTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTCTT
GGGTTAAAATGAGAACTGCTATTTTTGTTTTATGCTTTCTGACTTCCTCTAAATGTAATATTCTAAGTTAGGAATCTGCCAACGGCTGGTTGGCAGAATT
CCAATGCTATGCATGTCGCTCATTGGCTAACAGATGCTGCTTTTAGCCAATAGGAATCCTAAGTCTTTATGGACCACCCGTCGTGGTGATCGTGAATGTA
TGTGATGGAAGGTATGGATCTTGGACACGAAGCTCGGACTAAGCGGAGGGAGGGACGTCGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAA
TGAAGATTCGAAAGTGATTGAATTGTTGGAGCTTACACCCTACTGTTATAGACACGCGACCCTGCGTCCTATCACCTAGTGCATCTAATCAACCATCACT
CACCGGTGTTCATCCAATCATCCTACTCGTCTAATCATCGGTGGCGTAAACAACTTACCGTAATCACCATAATCAACGTGGGTTCGGATTGGACCGGTTC
GGGTTAACCGGTTAATGAGTACAGCTGGTACACAGTACCCAAGACCAGCAACCCTCAATACGCCCCCTCAATGCGAAGTCCCACGAATGCCGAGAGCCAC
CGTCAGATCCGTGTGGCGTGGTCCCGCAAGCGCCTTCGTCATGATGTCCGCTAGCATCACAGAAGTCTCGCAGTACTGGAGCTTGACTTCGCCGCGCTTG
ACTTCATCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGACCGTGGTTCACTGGGTTCTTCGTCATCTTGATGCACGACTGGTTGTCTTCGC
GGATCATGAGTTCGGGTCCAGTCTCATTAGCGGCCGCCAGAATCTCGCATAGCAGGCGATGAATCCACTTGCCTTCTTGGATAGCCAGACTGAGCGCGAT
GTACTCCGCTTCATTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTCATGAGCATGAACGTGTAGCCTGAAGTGGACTTGCGGTCGGCGAGGTCGCCGGC
CCAGTCCGCGTCCGAGTAGCCACGAAAGTCGATCTTGTCGCCCGGCTTGAAGCAGATCCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATACGCTTG
ACTGCAACCCAGTGTTCCTCTTGGGGGTTCCCCATGAAGCGCGATACATAGCCAACGGCGTACGCGATGTCTGGGCGCGTGGCGGTCATCAGGTGCATCA
GAGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCGCCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACCGGACTCACCACGGCCTTGCA
CTCGTCCATGGCGAAGCGCTTCAGGATGTCGTCCACGTATCGCCGCTGGCACATGGTCACGCTGCCGTCCGGGCCGTCCACCAACTCGATCCCAAGAACA
AACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAGGTCGGTCTTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGTACGTCAT
CCACGTACACCAGTACAAGCACGCAGTGACCGTCCACCACCTTGATGTAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATGGAGCACACGAATTC
GTCGAAGGTCTCGTTCCACACTCGCGAAGCTTGCTTGAGACCGTAGATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTCC
GGAACCACGCAGAAGACCACCTCCTTCATTATCCCGTACAGGAATGCTGTCACCACGTCGAGTTGGTCGAGGGGCCAGCCAAAATACTTAGCAATCGCGA
TCACCATGCGCAGCGTCACATACTTGACCACGGGCGAGAACGTCTCGGTGTAGTCAATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTT
GTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACACCCACTTGGTATCGATGGCGCGTTGTCCGTTAGGCAACTTGGCAGCTCGAAACACA
CCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCTTTGCGCCAGTGCAATTGATCAGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATA
GATCGGCTGCTGCTTCCACAGCGTTGGCACTGGCACGCCAAAACACTGGAGGCGTCGAGTCGTCGTCTTCATCTTGGTCCCACTTGCGCTTCCCCGCCTG
CTTGAAGCTCGTTTGGCGCGGTCCATCGTTGTCGTCCAGGTCCAGCGCGTCCAAGTCCAACACAGCATCATCGACGTCTTCATCCGAAGTATGCGTCGAA
AGTCCAAAGGTCGACTCATCGAAGTTGACATCGCGACTGATAACCACCTGCCCCGCCTCGATGTCATAAACTCGATACGCCTTGGACACTTCTTCGTAGC
CGAGGAACAGCCCGGCGCGAGCCTTGGGGTCCCACTTGCGCCGTCTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCAC
ACTCGGCTTGGACTTGTAAACGATCTCGAACGGAGTCTTGTGTTCGATCTTGGGTGATGGCAGACGATTCTTCACGTAGATGGCTGTCATGGCCGCCTCA
GCCCAGAAGCTCTTGTCCAGCTTGGCGTGATGCAGCATGCTGCGGCCAATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCG
CGTACGGAACCGTGGTTTGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGGGCTCCGTCGTGCCGCACAAACTT
GACCTTCTTGCCGAACTGCGTCTGCACCTTCGTGACGTACATCTTGATGCAGTCCTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCG
CTGGCTTCGTCCACGATCAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCACACGTCGAAGTGGAGCAGCTCGAACGTGTCGT
AGTGACGCTTGTCACGGTTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACACGTTTGGTCCACTCGACTTGGAAGGTGCCTT
CGCGTCCTTGATCATGTTGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGTAAGTCGACCGTCTTCCCACTGGTCGCC
GCATTCGCCGATCGCTGAGGCGTCTGGAGCCAGTAGAGTCCATCCACGAGGTTTGCCGTCGCCACCACTTGCTTGGAGCCCTTGTGCGCAATCTGCATCT
TGGTGCTGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACCGAAAGCAGATTCTTGCTCATGCTTGGGACGTACAGCGCGTTCTTGAT
CTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCG
CCTTCATTCCGCTCAATCAAATGAGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGTGTTGCGCCGCTGTCGACCGCCCCACAACCCGGACACATTCTTG
CCCGTCGAAATGCCACACTCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGTCGTAGTTGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGT
TGGCCCCGCGTCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCAATCGTGTGCCCCAATTT
CCCGCAGTACGTACACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCATTCTCCGTCTTCACCGTCGCCGTCTTCTCGCCTTGTCTCTTGATG
TGCTCATTCGTCAGCACCTTCACGACGTCTTGCGATCGTAGTTCAGCGCTGCTCATCTCCAAGTTCAGCACGACGTTCTCGTAGCTCTTGGGGAGGCTGC
GCAACAGGCAGATCGCCACGTCCTCATCCTCCATCTTCGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAATGATGCAAGACGTT
GCCGCCTTCCGACATCTCCATGCGGAAGAGTTGGCGCTTCAGGTAGATGCGTCCAGCCTTCTGCGAACCACCGTACAGCGTCTTCAGGCGCGTCCACGCA
ACCCACGCTTCCTCGCAGTCGTCGACCACATGGTGGTAGTCCGCGTCCATGTGGAGCAACATCAGTCCGAACGCGATGTTGCTCGACTTGACGTAGTCGT
CCTTGGCCCGCGAGTCCGTGAAGCTCGGCGTCGTCTCGCGGTTCACGACATGCCACGTCGACTTGGTCAGGAACACGCCACGCATGTAGCGGTTCCACGT
CGCGTAGTTGTCCCCGTTGAACTTGTCAATGGAGACCTTGGTCGAGGCGTCTTGGGCAGAGGACATGGTGCTTGGGCTCATAACCTGATGGAAGGTATGG
ATCTTGGACACGAAGCTCGGACTAAGCGGAGGGAGGGACGTCGCAGACGGCGGGACCGGAGCGAAGGCACTTGAGGGGTAGAATGAAGATTCGAAAGTGA
TTGAATTGTTGGAGCTTACACCCTACTATTATAGACACGCGACCCTGCGTCCTATCACCTAGTGCATCTAATCAACCATCACTCACCGGTGTTCATCCAA
TCATCCTACTCGTCTAATCATCGGTGGCGTAAACAACTTACCGTAATCACCATAATCAACGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATG
GGTACAACTGGTATACAGTACCCAAGACCAGCAACCCTCAATAAGGATGATTCCACGGAATAGTTTCTTGATCCCGAGTGCTTTGATGTCGCCGATAGAG
TCGGATCGGTACTCCTTGGGTAGAGCCGCCCCCCAGTTATCGATTTTGCTCATCGCTATGGTGGAAAGTATATCTAATAATACATAACTTGTATGAAAAA
TGGGATTTACAGCTCGGCCCCCATCTCAGGAATCGACTATCTTCAATCCAAACTTCTATGCGCTGGCTACAGACGTCCTAAGCCTTGAAATGGCGGATAC
TCTGTATCTGAGCAAGACTGACTATCGCATGAGCTATCTCTCATCGATCACGATGGGAGTGGCTAGTCCGATGTCAGCCCTGGTGCTTGATACCAATCTC
GATATAACAGGTATCAACTCGATCAGTTGCAGCTCGTTGAAGCTGAACGGCTCTAACATCGATCTCAGCAGCCTCTCACTACTAAGCGCGAGCCCTGGTA
CCGCAAGCAATAGTAAAGCTCTTATCGTTGGACCCACTGGTCAAATAGGAGGTCTATCTTCGGTTACAGCTACTTCGATCAATGGTACACTACAGACCGC
TGTTCAGCCTAACATCACAGTTGTAGGCACTCTCATTGGTCTCGTAGTGGGTGGTCCAACGTTTTGTACCCTATCGACGGCCGCGCAGCCCAATATTACA
TCGGTAGGCACATTGAGTGGATTAACGATTGCTGGCAACCTATCTTTTACCGGCACAAACCGCTCGCTGACAGGGTTAAATTCAATTGCTGCAACATCTA
TCTCAGGTACGCTGCAAACCGCATATCAGCCTAATATTACAACCGTCGGCACCCTCTCGACACTAACAGTAGCGAACGGAGTTATCGCATCTCAGTTGAC
AGGAACTCTTCTCACAGCTGCCCAACCCTATATTACATCGATTGGTACGCTAGCATCGCTTACCGTGTCAGGAGGAATCACTGGTGTTCTACAAACCGCT
GCACAGCCCAACATCACATCGGTTGGAACGCTAGGTTCGTTGAGTATAAATTCGGTGTTTGGCAAAGGATTAGTCATTCAGAATGATAGTACTACATCGA
CAGCCAGTCTCAATATCGTTTCGTATTTTCAGATGGAACAAGGCGTGCGGGGAAGCGCTAATGCTACAACACCTAACTGCTACTTCTGGCGATATGCTCT
TAGTGATCGGTTATTGATGGATATCAACGGAAATATTAATATCGGAGGATCTGCTATTAATACGGCATACAAACTTGATGTATCTGGAGCTATCCGCGCA
ACAGACATTACAGGTACGCTACAGACGGCTAGCCAACCCAGTATTACTAGTCTAGGAACTCTCATTGGCCTTGTAGTGGGTGGTCCAACGTATTGCACTC
TGTCCACTGCCACACAGCCCAATATAACATCGCTAGGTACATTGACTGGGCTATCAATCGCTGGCAATCTCTCTTTCGTAGGCTCCAGCCGATCGCTGAC
AGGATTATCATCGCTTACAGCTATTTCGATTGCTGGTACACTACAGACCGCGGCACAGCCTAACATCACATCGGTTGGAACGCTAGGTTCGTTGAGTATA
AATTCTGTGTTTGGCAAAGGATTAGTCATTCAGAATGATAGTACTACATCGACAGCCAGTCTCAATATCGTTTCATATTTTCAGATGGAACAAGGCGTGC
GGGGAAGCGCTAATGCCATCTCGCCTAATACATATTTCTGGCGTTTCGCAAATACCGATCTGCTGCTGATGGACATAAGCGGCAATCTGGCTATAGATCA
AGCTAGTATTAATACGGCATACAAACTTGATGTATCTGGAGCTATCCGCGGATCTAGCTTCGTTCAGGGAAATACTACTTACGATCTCTCTCTTATTCCT
CGACTATCCCTAACTACTCTAGGAACGGTTGAGGCAAGCAAGGCGCTTGTAGCTGATGCTTCATATGGTATTACCGGATTGAGATCCCTCTCAGTAGTTG
GATCGGGTCTCTCGAAGTCTCTCGTCATTCAAAATGACACTACTACATCAGCAGCTAGCATGAACTTTGTGAGCTTCTACCAGGCCGAATTGGGTGTTCG
CGGGTCAGCGAATACCTCGGGAGCAAATCAGTTCTTTCTCAAATATGCTTTGTCAGACCGTCTGATCATGGACACAAGCGGGAACATCAATATCGGAGGA
TCTGCTATTAATACCAACTACCTTCTAGAAGTCAATGGCGCGCTCAACTGTTCATCGCTCACGATTGGAGGAATACCAATCTCGCCTCAAACGAATATTC
TATCGATAACGCCTGGGACGACGTTTTCAAGTACAACAAGGGCAAGTGATTTCAATCTCAGTATTCGGAATCAGAGCAATACTGTTGGTGCTCAGGCCGG
AATATCGTTCACGATTGAAGGTACTAGTGATATGACAACGTACACCCCTAGCGTTAATCTATACTGTACGAGAACCGCTACGAGTACTCAATATTCAATG
AGTGATTTCGCTATCTCTACACGGTCAGGAGCTAATGCATTATCCCCAATGGCTGAACGTATGCGTATTACTCAGGCAGGTTATATCCGTTTTGGATCAT
CTACATCAACCGCAAAAATGGATATCACATCAAGCGCTAATCTACTATCCGGTAGCTGGCAGCGCGCGATGCGCATAGCTAATGATCAATCGACCCCTAT
CGAATTTGAGATTCAGATTTATAACGATGTGGCTGGCGGATCTAACGGCGTTGCTCTCGGCACTACTACGAGCGATCCGCTACGTCTCATGGTAAACAAT
AGTACTATTGCTTACCTCAACAGCTCTGGACGAATGGGGGTTGGTATCACATCGCCAGAAGCTACAATACACTCTGGCGGAGAGGTATGGGCCAACAATT
TCATGTACATCAAGGGAGGCGGAGATGGTTTCGCTCGATATCGATTCAATTGGAGCCAGGCTAACTACCCGGCCATTGACTCTGACTCGACCGTAGGTGC
TATCAGACTAGGGAGCTGCGATGCTAACTACAATTGGGTATCATATACCCCGGTGCAAAAGGAAGAACACTTGAGCAGTAGTTGGCAAAATGCAAAGTGA
TTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTTACTGGGTACACCCTACTGGATTCTCTACTGGATACAC
AGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCCTGTACCCACAATCATGGCGTAATCACCGTGACGTAATCATCGT
CCCGTAATCACCTGAATGATTGCGGTACAACACAGTGAAGGTCACGCCGACCTCACTGATGACGCGTTCGCGTCACACGGTCGCTTGGCGAGGCGTCGTC
ACATCAGTCTTGACAACACTCCCACTCGACTCGTCAGCGACCACGATGCCCAGCTTCGTCCTGAGCGCGTCGAACTGCGGCGCCGCGATCGGCTTCGTCA
TGATGTCCGCCAGCATGTCGAGTGTCGAAACATACTGCAACACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGTGCTT
GGTGCGCTTGTGGAACTCCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTCACCGCTTCATCGCTCGCCATCTCGCCCAGCTCG
CACAGAAACACCTTGAGCCACACCGCCTCCTGCGTGGCCTCCGACAGCGCCATGTACTCGGCTTCCGTCGACGAGAGCGCCACCGTGCGCTGCTTCTTGC
TTCGCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTTGCCGCTCGTACTCCGTCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCATTAAAAGGAAGAGCACTTGAGCAGTAGTTGGCAAA
ATGCAAAGTGATTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCAGCTACTGGATACCTCTTACTGGATACACCCTACTGGATTCTCT
ACCGGATACACAGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCCTGTACCCACAAGCATGGCGTTATCACCGTGAC
GTAATCATCGTCCCGTAATCACCTGAATGATTGCGGTACAACACAGTGAAGGTCACGCCGACCTCACTGATGACGCGTTCGCGTCACACGGTCGCTTGGC
GAGGCGTCGTCACATCAGTCTTGACAACACTCCCACTCGACTCGTCAGCGACCACGATGCCCAGCTTCGTCCTGAGCGCGTCGAACTGCGGCGCCGCGAT
CAGCTTCGTCATGATGTCCGCCAGCATGTCGAGTGTCGAAACATACTGCAACACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATG
TCGATGTGCTTGGTGCGCTTGTGGAACTCCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTCACCCCTTCATCGCTCGCCATCT
CGCCCAGCTCGCACAGAAACACCTTGAGCCACACCGCCTCCTGCGTGGCCTCCAACAGCGCCATGTACTCGGCTTCCGTCGACGAGAGCGCCACCGTGCG
CTGCTTCTTGCTTCGCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTTGCCGCTCGTACTCCGTCGAGACTCGATGTCGCCGGCCCAGTCCGCGTCC
GAGTAGCCTTGCAGTCCGTCCTCGCTGCTCGCTTGAAACACGAGGCCGTGCGTCTTCGTGCCTCGGATGTAGCGGAAGACCCTCTTGAGCGCCTGCCAGT
GTGTCGGACATGGATCCGCTGCGAACTGGCTCAGCACTCCCACTGCCGCTGCGAGGTCCGGACGAGTCCCCACCATGAGATACATGAGGCAGCCCACGGC
GTTCCGGTACGGAACATTCGCCATGGTCTCGTCGTGCTTGCAGCCTCCCTCGCACATGGCCTTGGTCAGCTTCAGACCCGGATCCTGCGGTGTCTTCACA
GGGTTGCTCTCATCCATCTTGAACTTCTCGAGAATGTCCTTCGCGAACTTGGTCTGCCGCACCGACACCTTCCCAGTCGCCACATCTTGCTCGATCTCCA
TACCGAGGAAGTACTTGAGCTGGCCCATGTCAGTCATCTCGAACCGGTCACTCAGCGCCTGCTTCGTGTCCTTCAGCGCCTGCTTCGTGTCCTTCAGCAT
CCCGTCGCTGCTGCTGGCGAGGACCAGATCGTCCACGTACAGTGCCACGAACATCATGTCGTGATTGTCCCGCTTCAAGTAGATGCAGTGGTCGGACTCG
CACTTCTTGAACCCCAGTTTCAACATGAACTCGTCGATCGTCTTGTTCCACATCCGCGGCGACTGCTTCAGACCGTACAGCGAACGCTTGAGCCGGCACA
CGTAGTCGGGTCGATCTCCGTCCACATATCCGTCCGGCTGCGCCATGTAGATGTCCTCGTCCAACAAGCCGTTGAGGAACGCGGTCTTCACATCCATCTG
GTGCACTGTGAGCTTGTACTTGGCCGCCAGACTCAGCAACACCCGAATCGACGTGAACTTGGCCACCGGCGCGAACGTCTCGTCGTAGTCGATGCCGTAC
TTCTGCGAGAACCCCTTCGCCACCAGTCGCGCCTTGAACCGCTCGATCTCTCCAGACTGGTTCTCCTTCACGCGGAACACCCATCTGCAGCCGATCGCCT
TGCGTCCCTTCGGCAGTGGCACCAGGGTCCACGTCTCGTTCTTGCGGAGCGACTCCACCTCCGAGTCGCACGCCTCTTTCCACTTGTCTGCGTCGCTGGA
TTCCATCGCCGACTTGAACGTTGTCGGCATCTCTCCCACTGAATCCACGACGTACGCAGCCTCGAAGTCTTCCTTCTCTTGTGCTGCGGCAGACATCTCG
TCCAGCGGCTGCTGTCGTCTCGGCACCGCATACCGCTTGGCACTCGGAACCTCCACGGCTTCCTCGAGCGACTGCGTGCGCGGGTGTCGCTTGCTGCCGG
GTACAAAGTCTTGATTCCGCGCAGCTTCTTCTCTGTTCTCGTCTGATCCGGACTGAGTCTCTTCATCCGTGGTGTCTTCATCATCATCTGTCGGAAGACC
CACCAACACCTCCTTCGAAGCGTAGTCGCGTCTCCCACCGTCGAAGACATCCTCCATGAACTGCGCGTCGCGGCTCACCAACACGCGACCGCTCTCGATC
TCCTCAAACCGATACGCCTTCTCGTGCTCCGAGTACCCGAGGAAACGACAGCGCACCGACCGAGCGTCGAACTTCGACCGCTTCTCCTTCGGCACGTGCA
CGTACGCGTGGCACCCGAACACCTTGAGGTTGGCCAGCAAAGGCTTCTTGCCGGTCCAAACGTGGTGCGGCGACTTGTCGTGACTGATGGCGCGCGTCGG
ACACCGGTTGCGGAGGAACGTGGCCGTCATCACCGCTTCTCCCCAGTACTCCTTCGACAACCCGGCGTGCTCCAGCATGCAGCGCGCACACTCCACCAGC
GTCCGATTCATTCGCTCGGCCACTCCGTTGAGCTGAGGCGTGTATGGTGGCGTGAACTTCTGCTCGATGCCGCGATCCGCACACAACTTGGCCATCGCAC
CCGAAGTGTACTCGCCGCCGTTGTCGCTCCGAAGCACCTTCACTCGCTTGCCGGTCTGCGTCTCAGCCAACGCGACGAACGCAGCGAACTTGGCAGCCAC
CTCCGACTTGTTCCGTAGCAGGTACACCACGCAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCTCCGAACGTCGCCGTCTGCATC
GGACCGCACACATCGCTGTGGACCACCTCCAGCACTTGCTTCGCACGGTTCGGCGACGACTTCATGAAGCTTACTCGCGTTTGCTTGCCGAGTGCGCACC
CGTCGCACACCTCCCACTGCTTCACCGACGTCATTGGGATGCCAGTGCCGTAGCCCTTCTTGACGATGGCGTCGAGACCACCATGGCCGATGTGACCAAG
TCGAAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATTCTTCGAGCTTGCCGCATTGGCCTCGTCAGCAGGCGTCCTCGGCGTCATGCAGAGCTTG
AACAGTCCTTTGCCTTCGCGAGCGCCGAGCTTCCACTTGAGACCCTTCGTTTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGG
TGAAGCGGCCGACGGAGAACAGGTTGCGCGACAGCTTCGGGATGTGCCACACACCCGTGAGCACACCCTTCTTCATGCCGCGCGGTGTCTGCATCGACAT
CACGATGTCGCCGCTCCCCACCGCCTGAACCACGCCGTCGTCCGCCAGATGCACGTCCACCGGAGAGATCTTCTTGTAGTTCTTCATGTACTCCTTCGAG
TACGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGCCGCTCAGCTTGGAGGCACCCGTGTCGCCACCAACCGAGAAGAGGAAGTCGCCAGAGT
CATCTTCGACCTGCGCGACGTTCGCTCGTTGCGGCCTCTGCCGCTCCCCGTTCTCGCGGATCCGCACCGGACACTTGGCGATCCAATGTCCGTGCTCGCC
GCAGTAGTGACAGGCGCTCGTCCTCTGCGCTTGCGCCTGCCGTCCCTTGCGCTTCCCGTTGTCGCTTGTCATGAACGCTTGACCTTGAGCGTGCGCGGTT
CCGTCAGCACCGCCACCTTGTTCCTTGCGCTTCATGTCCTCGTGCAGGAGCCGAGACGTCACGAGCTCCCACGTCAGCGTGTCGGAACGCGATTCCAACG
CCGTGATGAGGAACTGGTACGACTCGCTCAGACTGGCAAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCGACCGCGTCGAGCTGTTCCGC
CAGCGTCTTGAGCTTGTTAATGTGCTCCAGCACATCATCACCTTCGTCCATCGTTGTCGTGAAGAACCGTCGACGAAGAAAGAGCTTGTTCGCCAGGCTC
TTCTTCTCGAAGTGTCCCTCGAGTCTTGACCATGCATCATGCGCGTCCTTCGCCGACCGCACCAGCGGCAGCTGCGAGTCCTCCAACGCGAGACAGACGA
TCGCCAGCGCCTTGCGCGACTTCTTGCGAAACGTCGCTTGGTCCGCCGCGGTCGTGCACTGCTCGAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTC
GCGCTCCTCCAGCACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGGTTCCGTCGAACTTGTTGATGCGGGCGGTCGCGGTCGGGGCGGCGTCCATG
GCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGAAGAACACTTGAGCAGTAGTTGGCAAAATGCAAAGTGATT
CGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTTACTGGATACACCCTACTGGATTCTCTACTGGATACACAG
TTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCTTGGCGTAATCACCGTGACGTAATCATCGTCCCGTAATCACCTGAA
TGATTTCGGTACCACACAGTGAAGGTCACGCCGACCTCACTGATGACGCGTTCACGTCACACGGTCGCTTGGCGGGGCGTCGTCACATCAGTCTTGACAA
CACTCCCACTCGACTCGTCAGCGACCACGATGCCCAGCTTCGTCCTGAGCGCGTCGAACTGCGGCGCCGCGATCGGCTTCGTCATGATGTCCGCCAGCAT
GTCGAGTGTCGAAACATACTGCAACACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGTGCTTGGTGCGCTTGTGGAAC
TCCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTCACCCCTTCATCGCTCGCCATCTCGCCCAGCTCGCACAGAAACACCTTGA
GCCACACCGCCTCCTGCGTGGCCTCCGACAGCGCCATGTACTCGGCTTCCGTCGACGAGAGCGCCACCGTGCGCTGCTTCTTGCTTCGCCAGCTGATGCA
TCCGCCGTTCATCATGAACGCGTAGCCGCTCGTACTCCGTCGAGACTCGATGTCGCCGGCCCAGTCCGCGTCCGAGTAGCCTTGCAGTCCGGCCTCGCTG
CTCGCTTGAAACACGAGGCCGTGCGTCTTCGTGCCTCGGATGTAGCGGAAGACCCTCTTGAGCGCCTGCCAGTGTGTCGGACATGGGTCCGCTGCGAACT
GGCTCAGCACTCCCACTGCCGCTGCGAGGTCCGGACGAGTCCCCACCATGAGATACATGAGGCAGCCCACGGCGTTCCGGTACGGAACATTCGCCATGGT
CTCGTTGTGCTTGCAGCCTCCCTCGCACATGGCCTTGGTCAGCTTCAGACCCGGATCCTGCGGTGTCTTCACAGGGTTGCTCTCATCCATCTTGAACTTC
TCGAGAATGTCCTTCGCGAACTTGGTCTGCCGCACCGACACCTTCCCAGTCGCCACATCTTGCTCGATCTCCATACCGAGAAAGTACTTGAGCTGGTCCA
TGTCGGTCATCTCGAACCGGTCACTCAGCGCCTGCTTCGTGTCCTTCAGCATCCCGTCGCTGCTGCTGGCGAGGACCAGATCGTCCACGTACAGTGCCAC
GAACATCATGTCGTGATTGTCCCGCTTCAAGTAGATGCAGTGGTCGGACTCGCACTTCTTGAACCCCAGCTTCAACATGAACTCGTCGATCGTCTTGTTC
CACATCCGCGGCGACTGCTTCAGGCCGTACAGCGAACGCTTGAGCCGGCACACGTAGTCGGGTCGATCTCCGTCCACATATCCGTCCGGCTGCGCCATGT
AGATGTCCTCGTCCAACAAGCCGTTGAGGAACGCGGTCTTCACATCCATCTGGTGCACTGTGAGCTTGTACTTGGCCGCCAGACTCAGCAACACCCGAAT
CGACGTGACCTTGGCCAACGGCGCGAACGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAGAACCCCTTCGCCACCAGTCGCGCCTTGAACCGCTCGATC
TCTCCAGACTGGTTCTCCTTCACGCGGAACACCCATCTGCAGCCGATCGCCTTGCGTCCCTTCGGCAGTGGCATCAGGGTCCACGTCTCGTTCTTGCGGA
GCGACTCCACCTCCGAGTCGCACGCCTCTTTCCACTTGTCTGCGTCGCTGGATTCCATCGCCGACTTGAACGTTGTCGGCATCTCTCCCACTGAATCCAC
GACGTACGCAGCCTCGAAGTCTTCCTTCTCTTGTGCTGCGGCAGACATCTCGTCCAGCGGCTGCTGTCGTCTCGGCACCGCATACCGCTTGGCACTCGGA
ACCTCCACGGCTTCCTCGAGCGACTGCGTGCGCGGGTGTCGCTTGCTGCCGGGTTCAAAGTCTTGATTCCGCGCAGCTTCTTCTCTGTTCTCGTCTGATC
CGGACTGAGTCTCTTCATCCGTGGTGTCTTCATCATCATCTGTCGGAAGACCCACCAACACCTCCTTCGAAGCGTAGTCGCGTCTCCCACCGTCGAAGAC
ATCCTCCATGAACTGCGCGTCGCGGCTCACCAACACGCGACCGCTCTCGATCTCCTCGAACCGATACGCCTTCTCGTGCTCCGAGTACCCGAGGAAACGA
CAGCGCACCGACCGAGCGTCGAACTTCGACCGCTTCTCCTTCGGCACGTGCACGTACGCGTGGCACCCGAACACCTTGAGGTTGGCCAGCAAAGGCTTCT
TGCCGGTCCAAACGTGGTGCGGCGACTTGTCGTGACTGATGGCGCGCGTCGGACACCGGTTGCGGAGGAACGTGGCCGTCATCACCGCTTCTCCCCAGTA
CTCCTTCGACAACCCGGCGTGCTCCAGCATGCAGCGCGCACACTCCACCAGCGTCCGATTCATTCGCTCGGCCACTCCGTTGAGCTGAGGCGTGTATGGT
GGCGTGAACTTCTGCTCGATGCCGCGATCCGCACACAACTTGGCCATCGCACCCGAAGTGTACTCGCCGCCGTTGTCGCTCCGAAGCACCTTCACTCGCT
TGCCGGTCTGCGTCTCAGCCAACGCGACGAACGCAGCGAACTTGGCAGCCACCTCCGACTTGTTCCGTAGCAGGTACACCACGCAGAAGTGCGACTTGTC
GTCGATGAACGTGACGAAGTAGCGCTTGCCTCCGAACGTCGCCGTCTGCATCGGACCGCACACATCGCTGTGGACCACCTCCAGCACTTGCTTCGCACGG
TTCGGCGACGACTTCATGAAGCTTACTCGCGTTTGCTTGCCGAGTGCGCACCCGTCGCACACCTCCCACTGCTTCACCGACGTCATTGGGATGCCAGTGC
CGTAGCCCTTCTTGACGATGGCGTCGAGACCACCATGGCCGATGTGACCAAGTCGAAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATTCTTCGA
GCTTGCCGCATTGGCCTCGTCAGCGGGCGTCCTCGGCGTCATGCAGAGCTTGAACAGTCCTTTGCCTTCGCGAGCGCCGAGCTTCCACTTGAGACCCTTC
GTTTCCGCAAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCGACGTCCTTGGTGAAGCGGCCGACGGAGAACAGGTTGCGCGACAGCTTCGGGATGTGCC
ACACACCCGTGAGCACACCCTTCTTCATGCCGCGCGGTGTCTGCATCGACATCACGATGTCGCCGCTCCCCACCGCCTGAACCACGCCGTCGTCCGCCAG
ATGCACGTCCACCGGAGAGATCTTCTTGTAGTTCTTCATGTACTCCTTCGAGTACGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGCCGCTC
AGCTTGGAGGCACCCGTGTCGCCACCAACCGAGAAGAGGAAGTCGCCAGAGTCATCTTCGACCTGCGCGACGTTCGCTCGTTGCGGCCTCTGCCGCTCCC
CGTTCTCGCGGATCCGCACCGGACACTTGGCGATCCAATGTCCGTGCTCGCCGCAGTAGTGACAGGCGCTCGTCCTCTGCGCTTGCGCCTGCCGTCCCTT
GCGCTTCCCGTTGTCGCTTGTCATGAACGCTTGACCTTGAGCGTGCGCGGTTCCGTCAGCACCGCCACCTTGTTCCTTGCGCTTCATGTCCTCGTGCAGG
AGCCGAGACGTCACGAGCTCCCACGTCAGCGTGTCGGAACGCGATTCCAACGCCGTGATGAGGAACTGGTACGACTCGCTCAGACTGGCAAGAAGCGTGA
TCACCAAGTCGTCCTCGCTGACCGGAGCGCCGACCGCGTCGAGCTGTTCCGCCAGCGTCTTGAGCTTGTTAATGTGCTCCAGCACATCATCACCTTCGTC
CATCGTTGTCGTGAAGAACCGTCGACGAAGAAAGAGCTTGTTCGCCAGGCTCTTCTTCTCGAAGTGTCCCTCGAGTCTTGACCATGCATCATGCGCGTCC
TTCGCCGACCGCACCAGCGGCAGCTGCGAGTCCTCCAACGCGAGACAGACGATCGCCAGCGCCTTGCGCGACTTCTTGCGAAACGTCGCTTGGTCCGCCG
CGGTCGTGCACTGCTCGAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCCAGCACCATCTGCATCTTGAACTTCCATGTGTGGAAGTT
GGTTCCGTCGAACTTGTTGATGCGGGCGGTCGCGGTCGGGGCGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTC
ATAACCAAAAGGAAGAGCACTTGGGCAGTAGTTGGCAAAATGCAAAGTGATTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTA
CTGGATACCTCTTACTG